Molecular characterization of 16S rRNA Methylase armA producing aminoglycoside resistant Acinetobacter baumannii isolates

Molecular characterization of 16S rRNA Methylase armA producing aminoglycoside resistant Acinetobacter baumannii isolates

ABSTRACT

Acinetobacter baumannii is considered one of the most portentous pathogens which showed resistance against various classes of antibiotics and chemical disinfectants, enabling it as one of the notorious nosocomial bacteria. The present study was planned with the objective to isolate and identify A. baumannii from various clinical isolates of hospitalized patients for the determination of antibiotic resistance profile against commonly used antimicrobial agents also to examine the function of armA in aminoglycoside resistance. A total of 460 clinical samples from different sources (pus, urine, blood, etc.) were collected from various tertiary referral healthcare of Lahore.
218 belonged to gram-negative bacteria. A. baumannii were identified initially based on culture characteristics on blood agar and MacConkey agar, microscopic morphological features followed by biochemical confirmation using slide catalase, tube catalase, and DNase test. Isolates were further analyzed for sensitivity against different antibiotics through Kirby Bauer disc diffusion technique in accordance with the CLSI guidelines 2014. The MIC of Amikacin and Gentamicin was evaluated with the E-strips® (bioMérieux, France). Isolates were screened for A. baumannii
using A. baumannii Chrom™ agar initially and by cefoxitin disk method. Later genetically

confirmed by molecular typing of recA gene through pCR. Out of 218 clinical specimens, 68% (n=148) were found to be positive for A. baumannii, and the high rate of A. baumannii infections was found among male patients with a male to female ratio of 3 to 1 and within 21 to 40 years age group. All A. baumannii isolates exhibited a variable resistance pattern against Cefepime, Cefotaxime, Ceftazidime, Ceftriaxone, Ciprofloxacin, Imipenem, Amikacin, Meropenem, Tobramycin, Doxycycline and Gentamicin except Colistin and Tigecycline. armA was present among 37 isolates which represent a high-level of resistance against the antimicrobials. In the present study, we concluded that A. baumannii is highly prevalent among patients hospitalized in Lahore and males were more vulnerable to A. baumannii infections. The isolates of A. baumannii showed greater resistance against the commonly utilized antimicrobial agents. Tigecycline along
with colistin was observed as the most effectual drugs against the clinical specimens.

 

 

 

 

 

XIII
CHAPTER 1

Introduction

1.1 Background

A. baumannii is a bacterium among gram-negative, nonmotile and aerobics that has adopted remarkable efficiency of resistance to several antibiotics making it a multidrug-resistant (MDR) superbug causing serious hazards to the health of public (Garnacho-Montero et al., 2015; A. Y. Peleg, H. Seifert, & D. L. Paterson, 2008; Sengupta, Kumar, Ciraj, & Shivananda, 2001; Visca, Seifert, & Towner, 2011; Zhang, Zhang, & Qiao, 2013). Globally, A. baumannii is multidrug-resistant involved in hospitalized infections and community-acquired infections not easily be treated with general antimicrobials (Cerqueira & Peleg, 2011; Joly-Guillou, 2005; Sebeny, Riddle, & Petersen, 2008; Wisplinghoff et al., 2004). A Dutch bacteriologist Beijerink isolated the A. baumannii for the first time in 1911 from soil and named it as Micrococcus calcoaceticus (Asif, Alvi, & Rehman, 2018). After that, it had been reported with different names by many scientists. As it lacks movement and shows no pigmentation, Brison and Prevot suggested to placed it in the genus Achromobacter (Khatri, Singh, Subramanian, & Mayilraj, 2014). In 1968, Baumann et al included them in one genus Acinetobacter. After four years, the committee on taxonomy of the Moraxella and Allied Bacteria had given the approval of its placement by Baumannii. (Pantophlet, Brade, & Brade, 1999).

Microscopic organisms like that do not have flagella, which is a whip-like structure found in numerous microorganisms for movement, yet show jerking or a little movement. This might be because of the action of sort IV pili, shaft-like structures which can be expanded as well as withdrew. A little bit Motility in A. baumannii is because of the exopolysaccharide discharge that makes a film, help to move the bacterium forward (McQueary et al., 2012). Clinical microbiologists commonly separate individuals of the family Acinetobacter from the other Moraxellaceae through an oxidase test, since Acinetobacter spp. exist as the main individuals from Moraxellaceae that do not exhibit cytochrome c oxidases.

In all over the world, contagious diseases are responsible for the second major reason for the death along with the third primary cause of death in the United States (Talbot et al., 2006). In
the USA, Drug-resistant infections killed approximately 65000 people annually. There is more need for developing novel antibiotics to cope with gram-negative bacterial infections than for others. According to the several reports, the Gram-negative pathogen Acinetobacter baumannii has attained greater concern because of less availability of antimicrobials against its infections (Clark, Zhanel, & Lynch, 2016; Leclercq et al., 2013; Roca, Espinal, Vila-Farres, & Vila, 2012). As the hospital and community-acquired Multi-Drug Resistant A. baumannii appealed the World Health Organization (WHO) and the Centre for the Disease Control and Prevention (SDC) to enlist it as a serious threat and severe pathogen (Ong et al., 2009; Ozaki et al., 2009; Peng, Zong, & Fan,
2012; Vila & Pachon, 2008).

Adherence on the surface of the host cell is the first step of colonization for contamination by A. baumannii. Amid colonization, Acinetobacter baumannii may frame subcolonies and form a profoundly organized microbial network, called biofilm. Biofilm establishes a basic network of various bacteria attach with a living or non-living surface, encased in a capsule consisting of sugars, nucleic acids, proteins, and different macromolecules, comprising a defensive system to get by in unforgiving conditions and amid host disease (Arciola, Campoccia, Speziale, Montanaro,
& Costerton, 2012; Donlan, 2002; He et al., 2015). The microorganisms turn out to be progressively impervious to antimicrobial agents, antimicrobial, or cleaning as compared to their planktonic partners and in this manner the capacity for producing biofilm speaks to be an imperative infection causing approach (Jennifer A. Gaddy, Tomaras, & Actis, 2009; Lin & Lan,
2014).

A few reports have reported that the A. baumannii species can hold fast to the human cells and shape biofilm upon nonliving surfaces (Espinal, Marti, & Vila, 2012). Biofilms can be made by A. baumannii on lifeless things, for example, glass, plastic, on fingertips including other natural surfaces, albeit given with non-moisture conditions and supplement starvation amid expanded timeframes (Espinal et al., 2012; He et al., 2015). The A. baumannii survival was additionally credited with resistance against antimicrobial medications and parching by this microorganism (Tomaras, Dorsey, Edelmann, & Actis, 2003). As A. baumannii can create biofilm, it could also been credited with its capacity to draw biofilms on nonliving surfaces, especially from catheter- related urinary tract strains or circulation system contaminations and from shunt-related meningitis (Espinal et al., 2012; J. A. Gaddy & Actis, 2009; He et al., 2015; Rodriguez-Bano et al., 2009).
Mainly, A. baumannii infects the ICU patients with weak defences and with invasive devices. Acinetobacter baumannii has the tendency to survive under environmental conditions of wider range and this ability make it responsible for the spreading of infections and known as a primary, healthcare-associated pathogen (Jawad, Heritage, Snelling, Gascoyne-Binzi, & Hawkey,
1996; Perez et al., 2007; Sebeny et al., 2008). In the United States, A. baumannii causing ICU acquired pneumonia was reported between 5 and 10% of ICU cases (Begum, Hasan, Hussain, & Ali Shah, 2013). A. baumannii is also reported as a highly resistant pathogen in Pakistani hospitals (Evans, Hamouda, Abbasi, Khan, & Amyes, 2011; Kaleem, Usman, Hassan, & Khan, 2010).

Currently, the Acinetobacter infection treatment is challengeable due to its acquired Multi- Drug-Resistance, thus making difficult for physicians to opt effective antimicrobials (A.-P. Magiorakos et al., 2012; Manchanda, Sanchaita, & Singh, 2010). Development of resistant strains by the bacteria confers it to resist antimicrobials related to several classes. One of the important examples is the MDR pump. Multiple resistance determinants adopted by microbes is the main cause of MDR (Davis, Moran, McAllister, & Gray, 2005; Dent, Marshall, Pratap, & Hulette, 2010; Peleg & Hooper, 2010). Acinetobacter is an organism that can rapidly develop antibiotic resistance. In A. baumannii with Multi-Drug-Resistant strain AYE, 45 genes have been discovered responsible for resistance (P. E. Fournier & Richet, 2006; A. P. Magiorakos et al., 2012).

In literature, A. baumannii has been recognized with the terms of MDR and pan-drug resistant (PDR) from microbiologist along with the clinicians (Bonnin, Cuzon, Poirel, & Nordmann, 2013; Charfi-Kessis et al., 2014; Falagas, Koletsi, & Bliziotis, 2006; Leite et al., 2016; Naas, Namdari, Reglier-Poupet, Poyart, & Nordmann, 2007). In past, microbes were considered as Multi-Drug Resistant against three classes of antimicrobials mainly consist of aminoglycoside, carbapenem, antipseudomonal penicillins, quinolones, and cephalosporins while Colistin, tetracyclines, and ampicillin-sulbactam were included sometimes (Jain & Danziger, 2004). As the resistance was shown by A. baumannii against more antimicrobials including tigecycline, sulbactam, doxycycline or minocycline. So, it is included in the category of PDR. Previously, Sulbactam was used as bactericidal activity against A. baumannii but Lee et al reported Acinetobacter spp. strains resistant percentage to ampicillin-sulbactam was 57%.(K. Lee et al.,
2011).
During the past few decades, A. baumannii presented a greater task for the clinician as the organism had become extensive (XDR) drug resistant (A. Y. Peleg et al., 2008). Aminoglycoside antibiotics are a drug of choice for treating the various diseases produced by Gram-negative bacteria (Krause, Serio, Kane, & Connolly, 2016). Antibiotics mainly attached upon the A site of the 16S rRNA of bacterial 30S ribosomal sub-unit, inducing hindrance in the formation of a protein that leads to bacterial elimination (Doi, Adams, Yamane, & Paterson, 2007; Magnet, Courvalin,
& Lambert, 2001). Bacteria have developed the mechanisms to resist antibiotics by degrading the membrane permeability, active efflux, substitution of amino acid and by modification of enzymes (Chin, Gregg, Napier, Ernst, & Weiss, 2015; Choi et al., 2005; Costello, Deshpande, Davis, Mendes, & Castanheira, 2019; Coyne, Courvalin, & Perichon, 2011; Y. H. Liu et al., 2012; Poole,
2005). During the Afghan and Iraq war, deep wound infections, osteomyelitis, respiratory infections among military personnel’s had been reported as the sites of multi-drug resistant A.

baumannii (Anton Y. Peleg, Harald Seifert, & David L. Paterson, 2008).

Acinetobacter baumannii has developed resistance against the wide range of carbapenems,
�-lactam antibiotics, cephalosporins, quinolones, and aminoglycosides (Pierre Edouard Fournier, Richet, & Weinstein, 2006; Lin & Lan, 2014; Meletis, 2016). Survival of A. baumannii on human skin or dry surfaces makes it possible to easily spread in hospital settings within weeks and showed
resistance to a variety of disinfectants (A. Y. Peleg et al., 2008). Acinetobacter strains can easily transfer resistant genes by the horizontal gene transfer mechanism.

Acinetobacter species have been found highly resistant to antibiotics documented in numerous reports and scientific literature (Bergogne-Berezin & Towner, 1996; Chopra & Roberts,
2001; Doi, Murray, & Peleg, 2015; Falagas, Mourtzoukou, Polemis, Vatopoulos, & Greek System for Surveillance of Antimicrobial, 2007). Until 1970, the infections caused by Acinetobacter was treated with antimicrobials like gentamicin, nalidixic acid, ampicillin, carbenicillin, or minocycline applied as singly or in combinations of the same. But from 1971 to 1974, the Acinetobacter had shown the high rates of resistance according to successive survey reports (Dalla- Costa et al., 2003). Older antibiotics proved useless as the pathogen developed highly resistant strains and now many Acinetobacter species have become resistant to clinically used antibiotics
including broad spectrum as well as narrow spectrum and cephamycin’s comprised of mostly
aminoglycosides-aminocyclitols and cefoxitin (Bergogne-Berezin & Towner, 1996; Devaud, Kayser, & Bachi, 1982; Seifert, Baginski, Schulze, & Pulverer, 1993).

In the past, some of the broad-spectrum antimicrobials like tobramycin, cephalosporin, imipenem, and fluoroquinolones showed intermediate susceptibility but now, MICs data declared increased resistance against these antibiotics for Acinetobacter strains in the last decade. The most effective drug that had given 100% results was imipenem according to the research occurred in
1992 (Anstey, Currie, & Withnall, 1992). But according to the recent analysis of hospitals, some of the strains reported as imipenem-resistant (Tankovic et al., 1994). Difficulties have been observed while treating infections due to Acinetobacter. The MICs of A. baumannii showed that it is the most resistant to the imipenem while the MICs of carbapenem has remained below 0.3
mg/l. that’s why it is causing serious threats towards therapies in the near future (Bergogne-Berezin

& Towner, 1996).

In 2003, 16S rRNA methyltransferase a plasmid-mediated gene had proven as a major factor of high-level resistance in gram-negative rods against various clinically important aminoglycosides (Doi et al., 2007; Doi & Arakawa, 2007; Doi, Wachino, & Arakawa, 2008). At present, from Acinetobacter species, Enterobacteriaceae and Pseudomonas aeruginosa, there exist seven plasmid-mediated genes of 16S methyl-transferase e.g. rmtA, rmtC, rmtB, rmtE, rmtD, armA and npmA that had been reported (Doi & Arakawa, 2007). These 16S rRNA methylases genes can easily be transferred in other bacteria causing high-level resistance to antibiotics, therefore, these bacterial strains harboring armA should be kept under keen observation and monitored carefully.

Aminoglycosides had shown high affinity for the 16S rRNA to cope with gram-negative bacterial infections by blocking protein or by enzymatic modification but 16S rRNA methylation process is mainly responsible for the development of bacterial resistant to aminoglycosides that are clinically important. In 2003, Yamane et al identified Gram-negative bacteria resistant to aminoglycosides producing 16S rRNA methylase among the clinical specimens taken from France and Japan (Yamane et al., 2007). After that, it had been reported throughout the world and to almost all countries belong to Asia including Pakistan. (Wachino & Arakawa, 2012).
In A. baumannii, the 16S rRNA methylases are considered as a concerning agent in resistance to aminoglycoside, the study of these genes in clinical isolates is helpful in preventing and treating the diseases caused by the A. baumannii infections (Aliakbarzade, Farajnia, Karimi Nik, Zarei, & Tanomand, 2014; Cho et al., 2009; Galimand, Courvalin, & Lambert, 2003). A typical range from 0.03% to 95% in 16S rRNA Methylase genes prevalence as a basis of aminoglycoside resistance was observed (Aghazadeh et al., 2013). Among different types of Methylases, the armA resides among the A. baumannii (Bakour et al., 2014; Kim et al., 2008). The armA gene that attributes resistance to aminoglycoside, was initially discovered in 2002 in Poland from a gram-negative bacteria known as Citrobacter freundii, and later it was found in many Gram-negative species including the A. baumannii was found in North America , Africa, Asia and Europe (Kim et al., 2008; Milan et al., 2016; Tada, Miyoshi-Akiyama, Shimada, Shimojima, & Kirikae, 2014).

By sequencing the armA gene, it showed that this gene occurs on transposons aiding in its dissemination of resistance (Galimand et al., 2003; Galimand, Sabtcheva, Courvalin, & Lambert,
2005). Currently, in Europe armA is the most important 16S rRNA methylase-producing agent and is identified as a prevailing organism worldwide (Fritsche, Castanheira, Miller, Jones, & Armstrong, 2008). ArmA-carrying strains have been reported in high content in Europe in Bulgaria and continue to increase throughout the continents (Bogaerts et al., 2007; Strateva, Markova, Marteva-Proevska, Ivanova, & Mitov, 2012).

Peleg et al. studied in Korea 16S rRNA methylase-interceded abnormal state protection from amikacin and arbekacin have been accounted for as of late among the clinical specimens of the Gram-negative bacteria just from a few countries (Peleg & Hooper, 2010). They tried arbekacin and amikacin non-susceptible Gram-negative bacteria separated in 2003 and 2005 at a tertiary- care doctor’s facility in Korea through polymerase bind response to recognizing genes for 16S rRNA methylase. 14 isolates of the K. pneumoniae, 10 different types of the Enterobacteriaceae, and 16 A. baumannii exhibited armA alleles, though the rmtB gene was distinguished in 1 K. pneumoniae seclude. 16S rRNA methylase-delivering detaches were exceptionally impervious to arbekacin and amikacin and were for the most part co-resistant to levofloxacin. Generally, K.
pneumoniae confines likewise delivered broadened range D-lactamases along with plasmid-
intervened AmpC D-lactamases, also, A. baumannii secludes were non-susceptible against the

carbapenems.

Numerous aminoglycoside-creating actinomycetes utilized ribosomal resistance through

16S rRNA Methylation and the question raised concerning why in clinically pertinent species do not exhibit a similar mechanism of resistance. The answer was theorized that resistant instruments were present but were potentially missed due to restricted isolation strategies because the opposition example could imitate that of creatures delivering numerous aminoglycosides altering catalysts. From a plasmid grouping from the Citrobacter freundii at Poland, armA gene that encodes 16S rRNA methylase had been added in GenBank as well as the European Molecular Biology Laboratory in 2002. (increase number AF550415). No extra discoveries have distributed so far.

In gram-negative bacteria, the prevalence of resistance against the aminoglycoside owing to the 16S rRNA methylation is not fully acquainted. However, in Japan, the spreading of RmtA in P. aeruginosa isolates was surveyed to be in any occasion 0.4% during a national perception when separated by irregular state obstruction to diverse aminoglycoside sought after confirmation through PCR. Along these lines, RmtB has been recognized in countries like Japan, Taiwan, China, and South Korea belong to the Family (H. Lee et al., 2006). While ArmA has likewise been recognized among the clinical isolates of the Enterobacter cloacae, E. coli, Salmonella enterica, Acinetobacter species, Shigella flexneri, and S. marcescens, from different regions of East Asia along with the East and West Europe (Yamane, Wachino, Doi, Kurokawa, & Arakawa, 2005).

An ongoing report from a college doctor’s facility assessed the predominance of ArmA with 0.9% and RmtB as 0.3%, separately, when isolated by protection from amikacin and affirmed by PCR among Pneumonia and E. coli. In Japan and Brazil, two of the genes RmtA and RmtD have just been accounted, separately. These discoveries showed that genes of 16S rRNA methylase are as of now spread all-inclusive within the pathogenic gram-negative microbes (Doi et al., 2007).

Despite its right now low predominance, spreading of 16S rRNA methylase containing bacteria is a cause of worry due to several reasons. To start with, these gram-negative bacilli demonstrate had developed resistance against the majority of clinically helpful aminoglycosides, including
amikacin, gentamicin, and tobramycin and can’t be stopped by drug quantity changes. Secondly, most of the 16S rRNA methylases genes are related with portable hereditary components, for example, transposon, some of which have been demonstrated useful, furnishing them with the way to spread on a level plane to different isolates and to different species. Third, these living beings seem to have a greater ability for creating multidrug resistance, particularly by means of obtaining
the different genes of D-lactamases of 35 RmtB and ArmA positive isolates, 33 created SHY and
CTX-M type expanded range D-lactamases at Taiwanese college healing facility CYan, 2004). Comparable perceptions have likewise been made in South Korea CH. Lee et al., 2006). It has been accounted that auxiliary gene for the ArmA, highly predominant methylase up to this point, is
situated upon the composite transposon Tn1548 at the transferable plasmid and is every now and again connected with the CTX-M-3- like ESBL genes. In Pakistan, the presence of armA gene dire responsible for aminoglycoside resistance has not been reported in any study from A. baumannii isolates.
1.2 Problem Statement and objectives

The spreading of 16S rRNA methylase i.e. armA in the clinical specimens of A. baumannii and its role in the high-level of resistance against aminoglycoside among the indigenous strains.

Research mainly comprised of the following objectives:

• To study the antibiotic susceptibility profiling of A. baumannii clinical isolates collected from various hospitals of Lahore, Pakistan.
• Prevalence of armA mediated aminoglycosides resistance among A. baumannii.

• Relationship of the occurrence of the armA gene with minimum inhibitory concentrations

(MICs) of selected aminoglycosides.
1.3 Structure of the Thesis

The thesis includes research work in following paradigms;

1.3.1 Chapter 1

It is about the introduction of A. baumannii, its prevalence history and the objectives of our study.

1.3.2 Chapter 2

It is comprised of a review of literature related to the post work done by different scientists about

A. baumannii infections in previous years.

1.3.3 Chapter 3

It includes material and methods adopted by us in order to gain the required objectives. It mainly encapsulates different molecular techniques for the isolation as well as the identification of the A. baumannii and application of antibiogram for A. baumannii against different antibiotics then the role of the armA gene in its prevalence.

1.3.4 Chapter 4

This gives a complete view about the results of different tests applied during the study and the comparison of the prevailing rate of A. baumannii at various levels.

1.3.5 Chapter 5

It is about the discussion of the research work. It includes the comparison of results with other
scientist’s research for the significance of data and the conclusion about the present study.
CHAPTER 2

REVIEW OF LITERATURE

The Acinetobacter species are considered as important bugs responsible for nosocomial infections with substantial mortality (Merino et al., 2014; Sinha, Srinivasa, & Macaden, 2007). About greater than 32 Acinetobacter species, have been recognized by the scientists (Dijkshoorn, Nemec, & Seifert, 2007). Among different species of the gram-negative bacteria, Acinetobacter baumannii has developed the ability to resist most of the used antibiotics and leads to colonization of hospitalized patients causing serious infections with complexities in their treatment (Mak, Kim, Pham, Tapsall, & White, 2009; McConnell, Actis, & Pachon, 2013; Opazo, Dominguez, Bello, Amyes, & Gonzalez-Rocha, 2012). Owing to its potential for life-threatening infections, it is included into the list of most serious MDR pathogens i.e. P. aeruginosa, E. faecium, K.
pneumoniae, S. aureus, Enterobacter spp and A. baumannii briefly written as “ESKAPE”

(Garnacho-Montero et al., 2016).

The skin carriage rate of Acinetobacter species was observed by Seifert et. al. about 75% among the hospitalized patients (Seifert et al., 1997). But in A. baumannii, the organism the colonizing percentage is only about 0.5 to 3% while in human feces it is about 0.8% (Seifert et al., 1997). Acinetobacter requires an aquatic environment for colonization thus is a hydrophilic organism. Albeit Acinetobacter spp. could survive in hospital environments and in the outdoor, the sources of this pathogen is not completely understood and organism thought to be lived in both dry and wet conditions (Montefour et al., 2008). It can also survive in a broad range of temperature as well as pH (Cisneros & Rodriguez-Bano, 2002).

A. baumannii can be found at various sites of the body like the respiratory tract, urinary system infections, skin infections, surgical site infections, gastrointestinal system, and blood circulatory infections. It may also rarely find in acquired pneumonia, meningitis, mediastinitis(Chastre, 2003). These infections may counterpart due to irrational usage of broad-
spectrum antimicrobials, intravascular interventions and respiratory tract interventions (Cisneros

& Rodriguez-Bano, 2002).

Acinetobacter baumannii is of concern among the Gram-negative microbes which are usually MDR (Roca et al., 2012). Therefore, the treatment of MDR pathogen’s infections is

complex due to resistance to multiple classes of antimicrobials (Brotfain et al., 2016). Aminoglycosides are generally considered as an effective remedy against Acinetobacter baumannii (Akers et al., 2010; Q. Liu et al., 2015). Among the broad-spectrum antibiotics, aminoglycosides are mainly recommended the drug for the management of diseases produced by the gram-negative bacteria (Krause et al., 2016; Vakulenko & Mobashery, 2003). In general, tobramycin, gentamicin, and amikacin aminoglycosides are considered as the drug of choice and are extensively used against A. baumannii infections (Fishbain & Peleg, 2010; Viehman, Nguyen,
& Doi, 2014).

In a surveillance study conducted in five European countries, data obtained from ICUs about antibiotic susceptibility explained the prevailing A. baumannii resistance against gentamicin
was observed as 0-81% followed by ceftazidime 0 – 81%, amikacin was 10-51% , piperacillin-
tazobactam 36 – 75%, ciprofloxacin 19 – 81%, and for imipenem was 5 – 19% (Hanberger et al.,

1999). Similar results had reported by The MYSTIC (Meropenem Yearly Susceptibility Test Information Collection) system that examined A. baumannii strains of 490, that were obtained from 11 European countries from 37 centers during three years of 1997 to 2000 (Turner, Greenhalgh, & Group, 2003). According to the report, meropenem, as well as imipenem, were highly effective antimicrobials against the A. baumannii with the resistant percentages of 18% and
16% correspondingly. While the data obtained from the other 12 countries included in the MYSTIC program showed significant resistance rates for meropenem was (43.4%) and for imipenem it was (42.5%) (Turner, 2008).

There are two mechanisms adopted by the A. baumannii for the antibiotic resistance i.e. Aminoglycoside-modifying enzymes (AME) and 16S ribosomal RNA (16S rRNA) methylation (Atasoy, Ciftci, & Petek, 2015; Cho et al., 2009). The resistance against the aminoglycoside through ribosomal methylation detected as the major factor in inducing high-level resistance in Gram-negative microbes (Bakour et al., 2014; Galimand et al., 2005). Recent findings have
exhibited 16S rRNA causing an elevated level of resistance with MIC >512 ug/ml to the majority

of aminoglycosides (Doi et al., 2007; Doi & Arakawa, 2007; Montefour et al.). The aminoglycoside resistance through the post-transactional rRNA methylation via 16S rRNA methylases is another important mechanism adopted by the organism.

In Japan, Pseudomonas aeruginosa contained 16S rRNA methylase gene, identified for the first time and named as rmtA in 2002. Some of the other methylases genes have been reported in both human patients and animals, named as rmtD, rmtC, rmtB and armA (Bogaerts et al., 2007; Doi et al., 2007). The antimicrobial resistance mechanism of Acinetobacter is autoprotective and confers resistance through ribosomal methylation by genome-encoded methyltransferases (Kojic, Topisirovic, & Vasiljevic, 1996).

In clinical isolates, armA was the methyltransferase gene that uses the methylation mechanism (Cho et al., 2009). As the small plasmids are the site of these genes, so these can easily be transmitted (Zhou et al., 2010a). The study of the occurrence of these genes will be helpful to identify the extent of aminoglycoside resistance among A. baumannii that ultimately will help to understand the appropriate remedy and protective measures for their treatment and prevention (Zhou et al., 2010a).

Both the 16S rRNA methylases and AMEs among A. baumannii strains pose a serious threat for the future treatment of antibacterial chemotherapy. It is important to adopt the best possible therapy to treat patients and making the policies to control the prevalence of resistant genes (Aliakbarzade et al., 2014). Although these resistant determinants are increasingly being observed all over the world thereby abating medication options against the A. baumannii infections in clinical settings (Vila & Pachon, 2008).

Huang J. et al studied Acinetobacter baumannii strains acquired from a training emergency clinic were contemplated for the hereditary premise of their protection from aminoglycosides. A. baumannii resistance rate against aminoglycoside was observed as (76.9%) whereas, aminoglycoside-resistant strains were 66.25% (53/80), demonstrated high resistance against aminoglycosides i.e. amikacin, gentamicin, and tobramycin with minimum inhibitory
concentrations greater than 512 u g/ml (MIC≥512ug/ml). According to the Huang et al. the
nearness of aminoglycoside-altering compounds showed intermediate-level resistance against aminoglycosides in A. baumannii, while high-level resistance to aminoglycoside was linked to the occurrence of armA gene (Huang, Ye, Jia, Yu, & Wang, 2019).

 

 

To follow the danger of multidrug-resistant A. baumannii, an examination was performed, intended to decide the commonness of carbapenemases in A. baumannii resistant to aminoglycosides for more than two years in the hospital of the Chengdu Medical College at Chengdu, China. The outcomes demonstrated that greater resistance level against the aminoglycosides was observed by 75 (3.56 %) specimens, against gentamicin and amikacin (least
inhibitory focus, �256 ug/ml), Among the 54 isolates of armA-positive, the commonness of

carbapenem safe blaOXA-51 and blaOXA-23 genes was 100% and 79.63%, separately. The armA,
aac (6′) -Ib as well as ant (2″) -Ia were certain among 43 isolates. Taking everything into account, in western China A. baumannii containing aminoglycoside along with carbapenemases resistant catalysts were incredibly predominant, stressing the need to embrace observation projects to
understand the restorative difficulties at present (Wang et al., 2016).

Sheikh alizasde et al. examined the function of the resistance mechanism of A. baumannii to various aminoglycosides in 2016. The study went for to think about different systems towards aminoglycoside non-defenselessness in A. baumannii isolates. Co-relation of armA was distinguished in 40.3%, 29.2%, 34.2%, 64.2% and 34.4% of disengages indicating non- vulnerability to amikacin, gentamicin, tobramycin, netilmicin, and kanamycin, respectively. The results spoke to an authoritative connection between quality of genes encoding AME like armA and resistance against aminoglycoside by A. baumannii (Sheikhalizadeh et al., 2017).

An examination directed in 2010 to test the association of antimicrobial susceptibility and aminoglycoside resistant genes in Acinetobacter spp. Isolates were taken from hospitalized patients. The resistance rate was observed against amikacin, tobramycin, and ceftazidime independently while ampicillin/sulbactam was declared as an effective drug against these organisms. The samples taken from ICU and of blood tests showed increased MDR rates. 60% of the confines comprised of acetyltransferase characteristics aacC1, phosphotransferase aphA6, and
adenylyltransferase characteristics aadB (3.3%) and aadA1 (41.7%), were less told. 21.7% of the strains comprises three aminoglycoside resistance characteristics (aadA1, aacC1, and aphA6) The findings revealed that clinical confines of Acinetobacter in our therapeutic facility passing on various sorts of aminoglycoside-resistant genes (Moniri, Farahani, Shajari, Shirazi, & Ghasemi,
2010).

According to another research the hereditary premise of elevated resistance versus aminoglycoside among the clinical specimens of the A. baumannii from Beijing, China, five
adjusting catalyst genes (aac(3)- I, identification rate of 65.69%; aac(6′)- Ib, discovery rate of
45.10%; aph(3′)- I, location rate of 47.06%; aph(3′)- IIb, recognition rate of 0.98%; ant(3″)- I, recognition rate of 95.10%) as well as one methylase gene (armA, recognition rate of 98.04%)
were distinguished within 102 A. baumannii possessing aac(3)- I+aac(6′)- Ib+ant(3″)- I+armA
(location rate of 25.49%), aac(3)- I+aph(3′)- I+ant(3″)- I+armA (recognition rate of 21.57%) and ant(3″)- I+armA (identification rate of 12.75%) being the highly predominant quality genes. The estimations of chi-square test indicated the connection of armA, ant (3″)- I, aac (3)- I, aph (3′)- I and aac (6′)- Ib with HLAR. armA had a critical connection and great possibility with HLAR. The elevated level of HLAR can trigger a major issue for mix treatment of D-lactams with the

aminoglycoside against various A. baumannii diseases. Since the armA was accounted for having the capacity to produce the high-level of resistance against the aminoglycoside from a large portion of the clinical critical aminoglycosides (tobramycin, amikacin, gentamicin and so on), the capacity of aminoglycoside altering compound gene(s) within A. baumannii conveying armA for further examination (Nie et al., 2014).

There are two imperative systems adopted by microbes in order to gain protection from aminoglycosides i.e. AMEs and 16S rRNA methylases. A research was conducted to decide the predominance of 16S rRNA methylase ( rmtC, armA, rmtA, rmtD, as well as rmtB), along with
the AME genes [aac (3)- I, aac (6′)- Ib, , aac(6′)- Id, aph (3′)- I and ant (3”)- I], among the clinical

isolates of the A. baumannii at Tehran, Iran in 2015-2016. An aggregate of 110 clinical specimens of A. baumannii was segregated from the patients in two showing medical clinics in Tehran, Iran. The outcomes demonstrated that colistin was a viable anti-infection and could be utilized if all else fails treatment of diseases brought about by MDR-AB. The resistance rate to aminoglycosides were 100%, 96.36% and 90.9% for tobramycin, gentamicin, and amikacin, separately. In this
examination, AME genes of ant (3”)- I , aac (6′)- Ib and aac (3)- I were most predominant among

the detached strains. Markedly high resistance from tobramycin, gentamicin, and amikacin was noted in this investigation.

16S methylases are associated with an increased level to aminoglycoside resistance within gram-negative bacteria. A study conducted in China in which more than 200 Gram-negative isolates were collected and examined for methylase gene transfer and aminoglycoside resistance in the hospital of Shanghai in 2007. In the clinical settings of Pseudomonas aeruginosa and Acinetobacter baumannii and, 94.7% (89/94) armA or rmtB were reported while among this predominant was armA (84 versus 5 strains with rmtB). Enterobacterial monotonous intergenic agreement arrangement (ERIC-PCR) showed the horizontal transfer and clonal dispersal as a mode of the prevalence of armA and rmtB genes (Zhou et al., 2010b).
CHAPTER 3

MATERIALS AND METHODS

The present study was performed for 6 months from 2nd April to September at Virtual University Lahore, Pakistan. For this purpose, five tertiary care hospitals of Lahore were selected for the collection of specimens.

Initially, phenotypic methods were applied to identify the bacteria of choice and further confirmation was done through genotypic methods. Disc diffusion assays were employed to examine the antimicrobial susceptibility for Acinetobacter baumannii strains and then molecular techniques were used to evaluate the genetic basis of multiple drug resistance phenotypes.

 

3.1. Equipment’s, Chemicals and Culture media

Pyrex® made glassware was used in the present study. The glassware was dipped within the chromic acid before washing for almost 24 hours. From liquid soap, the glassware set was thoroughly washed and then kept in a hot air oven for drying purpose. For sterilization, glassware, culture media and solutions were covered with the help of aluminum foil and placed within the
autoclave. The antibiotic discs and growth media used was of Oxoid, (Yamane et al.). Merck™,
Sigma™, Favorgen™, and Thermo scientific™ was the source of the agency to get other reagents, chemicals and kits.

 

 

3.2. Bacterial isolates obtained from Different Specimens

A total of 148 isolates of A. baumannii included in this research were taken from various clinical specimens taken from blood, body fluids (pericardial, peritoneal, pleural and synovial)
,cerebrospinal fluid (CSF), pus, urine, sputum, catheter tip, wound swabs, central venous pressure (CVP), throat and ear swab, wound tissues and soft tissues, tracheal secretions, PVC tip samples, tip of Foley catheter and endotracheal tube (Fauci, Touchette, & Folkers) and bronchial washing
sample. standard microbiological techniques were applied for the initial identification of isolates

(Forbes, Sahm, Weissfeld, & Bailey, 2007).

Overnight Luria Broth (LB) and glycerol with the quantities of 750 u L of 50% (v/v) and 750 u L culture were mixed with bacterial isolates respectively and poured in sterile screw-capped tubes. The bacterial isolates were stored at -80°C.

3.3. Clinical isolates Identification

Phenotypic tests like;

o Gram staining

o Lack of motility

o Colony appearance o Positive catalase test o Negative oxidase test

Were performed to identify the desired organism. After that, it is confirmed by employing molecular techniques.

3.4. Molecular Characterization by PCR

For molecular characterization of the clinical isolates, PCR based techniques like multiplex PCR

along with ribotyping were carried out employing the genus as well as species-specific primers.

3.4.1. Preparation of A. baumannii genomic DNA

The process includes the following steps;

• Using LB broth (app. 10ml) at 37℃ temperature, the genomic DNA of the A. baumannii

was cultured overnight.

• Bacterial culture of 1 ml quantity was taken into a sterile Eppendorf tube and then these tubes were kept for centrifugation at 12000 RPM for 2 minutes.
• The supernatant was discarded, and the cell pellet was suspended in 1X PBS buffer (pH

7.4) and centrifuged again with the sole purpose of washing the cells.
• FavorPrep™ Tissue genomic DNA Extraction Kit (Favorgen Biotech™ Corporation,

Taiwan) was used for the extraction of DNA from the broth free pellets of the cell.

• To dissolve the bacterial pellet, the FATG1 Buffer (200 u l) was poured in Eppendorf tube and then properly stirred by utilizing a sterilized pipette tip.
• In Eppendorf tubes, 20u l of Proteinase K was added and blended upon the vortex mixer.
• The Eppendorf tubes were kept for incubation at 60℃ in a dry bath for 1 hour.

• Samples were loaded with 200u l of FATG2 buffer and then mixed with the help of vortex mixer.
• All the samples were again incubated at 70℃ for 10 minutes.

• Each tube was loaded with absolute ethanol (200 u l) and blended upon the vortex mixer.

• Series of tubes were prepared with FATG Mini Column. After a little vortex, the above mention prepared sample was poured in these tubes.
• Centrifugation for 1-2 mins at 14000 RPM was done.

• Then separated the FATG mini columns.

• W1 Buffer i.e. 400 u l (having ethanol) was added in the column and then centrifuged for about 1-2 minutes at 14000 RPM. Flow-through was discarded.
• Wash buffer of 750 u l was added in the FATG mini-column.

• The flow-through was discarded and centrifugation was done again at 14000 RPM for 3- four minutes.
• On the membrane of the column, preheated Elution buffer of 100u l was transferred carefully.
• Finally, to elute the DNA the tubes were again centrifuged at 14000RPM for 2 minutes.
3.4.2. Quantification of genomic DNA of A. baumannii

Quantification was done by measuring the optical density (OD) at 260nm and 280nm with the use of a spectrophotometer, For the quantification, 2ul of extracted DNA was added in the distilled water (98ul) in order to make the dilution of 1:50. The measurement of optical density was done,

and the genomic DNA concentration was taken into consideration with the help of following;

eoncentration of DNA (ug/ml) = OD at 260nm x Dilution Factor x 50

By calculating the ratio of 260 nm/280 nm, DNA quality was tested. For further investigation, the

DNA pattern showing ratio value less than 1.80 was taken into consideration as pure.

 

 

3.4.3. Multiplex rcn

Multiplex peR technique was employed to confirm the A. baumannii on the molecular basis as previously explained (ehen et al., 2007). The technique uses the following steps;

o Briefly, amplification was done for two conserved regions, a 425-bp fragment of recA gene and a 208-bp fragment of ITS region from A. baumannii by using specific pairs of primers (Figure 3.4.3).
o The peR was carried out with the following reagents i. 2X peR Master Mix with 12.5u l,
ii. Forward and reverse primer (10 u m) with 1u l iii. 1u l template
iv. A total quantity of 25 u l was maintained.
Specific conditions for the Kyratec Super Cycler SC300 set as following:

5 minutes: 94℃

30 seconds: 94℃
30 seconds:

30 seconds: 55℃
72℃ 35 cycles
5 minutes: 72℃

 

 

 

 

 

 

 

 

 

Table 3.4.1: Primers used for the Multiplex PeR for confirmation of the A. baumannii

 

Genes Primers

Name Sequences

(‘5 to 3’) Annealing temperature Product size References
recA P-rA-F CCTGAATCTTCTGGTAAAAC 55°C 425-bp (Chen et

al., 2007)
P-rA-R GTTTCTGGGCTGCCAAACATTA

C
ITS

region Ab-ITS-F CATTATCACGGTAATTAGTG 55°C 208-bp
Ab-ITS-R AGAGCACTGTGCACTTAAG

 

 

 

 

 

 

 

 

 

 

 

22

 

3.4.3.1 Agarose Gel Electrophoresis

To examine 5u l of amplicons were assessed;

o Agarose gel (1%) was electrophoresed at 110V for almost 35 mins.

o The buffer used was 1X TAE buffer with 10mg/ml concentrated ethidium bromide of 3u l.
o 1 kb ladder of GeneRuler™, Thermo Fisher Scientific Inc,, USA was used to determine the change in the length of the amplicon.

 

 

3.5. Antimicrobial susceptibility Against A. baumannii

3.5.1 Preparation of the 0.5 McFarland turbidity standard

o Initially, 1.175% solution of barium chloride was mixed with 1% sulfuric acid (H2S04)

solution in the determined composition of 0.5 ml and 99.5 ml respectively.

o The mixture was stirred thoroughly.

o A spectrophotometer was used for the measurement of optical density at 625nm wavelength and suitable absorbance between 0.08-0.03 was appropriate.
o 10 ml screw capped sterile glass tubes were used to be filled with a standard solution.

Bacterium inoculum was prepared in the tubes of similar size.

o The McFarland tubes were wrapped by the Parafilm and then placed separately inside the dark room.
o They can be stored for a month to use later. Before usage, the turbidity standard was mixed with the aid of gentle mixing with the help of vortex mixer. Then tested for uniform turbidity.
3.5.2. Control Group

To know the validity of results of susceptible values, the control organisms had been considered for each batch. The E. coli (ATCC® 35218 along with ATCC® 25292), as well as P. aeruginosa (ATCC® 27853), were considered as the control organisms for analyzing the outcomes of inhibition sectors along with the Minimum Inhibitory Concentrations accordingly CLSI tips (CLSI, 2014). The control strains results were then compared with the already known values in other case, conditions were repeated.

 

 

3.5.3. Disc Diffusion assays

o From dehydrated agar powder, the Mueller Hinton agar was prepared (Oxoid, UK).
o After that, it was sterilized at 121℃ and set at 50℃ for cooling purpose within the water tub.
o Petri dishes with a diameter of 90mm are taken out and 25ml of agar was transferred into it.
o The agar was cool down. The plates were utilized on the same day or could be stored at a temperature of 4℃ and used within a week.
o For sterility purpose, the representative sample was placed at 35℃ for at least 48 hours.

 

 

3.5.3.1 Antibiotic Discs

o Commercially available discs of antibiotics were store at 4℃ and unpacked 1-2 hours before their usage. Names of the antibiotic discs are provided in the table 3.5.1.
o Plates of nutrient were prepared within the 0.85% saline suspension were prepared and incubated for one day. After that, the inoculum of bacteria was formed by interspersing of isolated colonies from plates.
o The suspension of bacterial turbidity was matched with the McFarland (0.5).
o To adjust the turbidity of bacterial inoculum suspension, disinfected cotton swabs were soaked in every inoculum of bacteria.
o By rotating the tube, the extra inoculum was removed. To spread the bacterial inoculum, the swabs were streaked upon the plates via agar plate rotation.
o In the end, the agar plate rim was swabbed, and it was kept open for 3-5 minutes for permitting the absorption of the agar surface moisture before placing the antimicrobial discs.

The discs of antimicrobials were positioned upon the surface of the agar plates after inoculating with the use of sterile forceps. Then pressed to make certain an intensive touch with the agar surface. The antimicrobial discs were positioned at some distance so that they’re not closer with each other. Before the usage of antibiotic discs, the plates of agar were transferred within the
incubator at the temperature 35℃ for 15 mins.

After incubation for 18 hours, the inhibition zones were calculated with the help of scale at the back of the agar. It is normally measured in millimeter because of the no visible growth at the margins. By using CLSI tips, the sector of inhibition was determined and noted in terms of three categories viz, susceptible, intermediate, or resistant to antimicrobials (CLSI, 2014).

 

 

 

 

 

Table 3.5.1: Antimicrobial Discs with abbreviations

No. Antibiotic discs Abbreviations
1 Amikacin AK
2 Gentamicin CN
3 Tobramycin TOB
4 Meropenem MEM
5 Ciprofloxacin ClP
6 Piperacillin-Tazobactam TZP
7 Cefepime FEP
8 Cefotaxime CTX
9 Ceftazidime CAZ
10 Ceftriaxone CRO
11 Trimethoprim-Sulfamethoxazole SXT
12 Ampicillin Sulbactam SAM
13 Colistin CT
14 Doxycycline DO
15 Tigecycline TGC

 

 

 

 

 

 

 

26
3.5.4. Determining Minimum Inhibitory Concentration

Broth microdilution approach (BMD) was used to determine the MICs of several antimicrobials in combinations against the isolates of A. baumannii. Inside the broth, a 2-fold dilution was made up to11 dilutions of the antimicrobial agents.

Following steps were taken into consideration;

o For the estimation of minimum inhibitory concentration, 2X Mueller Hinton broth was utilized.
o The serial dilution of the 4X antimicrobial solution was performed whereas the preparation of inoculum of bacteria was done distinctly.
o 100u l of broth (2X) was poured within every 96 wells.
o Bacterial suspension (50u l) were mixed with antibiotic dilutions and incubated at 35℃

for 18 hours.

o No visible growth with the lowest antibiotic concentration was denoted as the MIC of that antimicrobial.

The pure antimicrobials powder was purchased from the market without delay and from business suppliers. The efficiency was marked as the u g and %age of the active component and International Units in (IU)/mg. The antimicrobials were saved as per the recommendations of
suppliers, in another case they were transferred in closed containers in the dark at 4℃. By adding

the sterile distilled water, the antimicrobials were dissolved as well as diluted. The working and stock solutions were made and utilized on the same experimental day otherwise the storage of stock solution was carried out at -80 °C and used within a month .

From 18 to 24 hours agar media, an inoculum of bacteria was performed through the mixing of colonies. Around 4 to 5 colonies from the growth on the nutrient were picked for this purpose. By using a loop, colonies were placed in a sterile solution of saline (0.85%) by adjusting the turbidity to 0.5 McFarland standard. In 96 well plates, the bacterial density (5 x 105 CFU/mL) was provided by the dilution of the same inoculum. For this purpose, a tube having saline (4.9ml) was added by (0.1 ml) in bacterial suspension according to 0.5 McFarland. This is equivalent to an OD
of 2 x 106 CFU/Ml that after the mixing with same quantity solution for a specific both and antimicrobials give rise to a final required inoculum of 5 x 105 CFU/mL.

MICs of bacterial isolates were checked against 11 concentrations of antimicrobials by using

96 well micro-titration plates. Further, the following steps were taken into consideration;

a) The plates were uncovered and then labeled properly.

b) Each row was utilized for the specific strain of bacteria against the antimicrobial agents for

11 different two-fold dilutions

c) In 96 well plate, Mueller Hinton broth (2X) of 100u l was poured in every well.

d) The (4X) antibiotic solution of 50u l along with the suspension of bacteria (2 x 106
CFU/mL) was interspersed and then kept within an incubator for 18 hours at 35℃.

e) Viable cell counts were performed sporadically on the suspensions of bacterial inoculum to confirm the counts by taking 10 u l from growth well followed by the blending within saline of 10 ml.
f) On the surface of the nutrient agar plate, 100 u l from the dilution was dispersed and incubated on the same day.
g) The column number 12 of every row was considered as the growth control as the well was not introduced by any antibiotic.
h) The inoculum purity was assessed after pouring it on nutrient agar followed by the incubation.

The MIC showed the lack of turbidity by inhibiting the bacterial growth represented as the best dilution of antimicrobials. The reference strains were run alongside the batch as the control for evaluating the efficiency of antimicrobials, culture media along with the conditions. To observe the occurrence of satisfactory growth, column 12 was examined and the plate was examined for the absence of growth.
3.6. Screening of armA gene

The amplification of the 16S methylase gene together with armA genes was carried out using primers (Table 3.6.1) by adding the following;

• sterile polypropylene tubes 0.2u l with a volume of 30 u l reaction having

• (2X) pCR Master Mix 15u l

• 1 u l of both primers (10 u M),

• 2 u L of pattern DNA.

In pCR Thermal Cycler, strategic settings were;

o The temperature for denaturation was 94°C for almost 5 mins,

o accompanied by means of 35 cycles of 94°C for 30 seconds,

o 55°C for 30 seconds, 72°C for 45 seconds

o a final extension at 72°C for 7 minutes.

1 % agarose gel was electrophoresed to examine 5u l of amplicons in 1X TAE buffer with 3u l ethidium bromide having 10mg/ml concentration at 110 Volts for 35 minutes. 1 kb ladder
(GeneRuler™, Thermo Fisher Scientific Inc,, USA) was used to determine the change in the

amplicon size.

 

 

3.7. Extraction of DNA from agarose gel:

The procedure involved the following protocol;

I. FavorPrep™ Purification Kit was used to extract the pCR products from the gel.

II. A clean blade was used to remove the extra gel thereby reducing the quantity of gel. The gel slice with 300mg weight was moved into a microcentrifuge tube.
III. 500u l of FADF Buffer was poured in the tube, agitated on a vortex mixer and placed for incubation for 5-10 minutes at 55℃,
IV. In order to thoroughly disperse the gel slice, the tube was again placed on a vortex mixer for 2-3 minutes recognized through the yellow color of the sample mixture.
V. In Eppendorf tubes with FADF columns, 800 u l of sample was transferred upon cooling.

Centrifugation of the sampled tubes was done at 11000 RPM for 30-60 seconds.

VI. Flow-through was removed, 750 u l Wash buffer containing ethanol was shifted to the column. Then it was centrifuged for 30-60 seconds at 11000 RPM.
VII. Flow through was discarded again and the centrifugation was carried out for 3-5 minutes at 18000 RPM to made columns completely dried.
VIII. The labeled Eppendorf tubes were used to fill with FADF columns.

IX. At the middle of the columns, these were loaded with an elution buffer of about 40-50u l. X. After 60 seconds,the tubes were kept for centrifugation for 2 mins at the 14000 RPM.
XI. Sealed the eluted DNA products and saved at -20℃,

 

 

 

 

 

 

 

 

Table 3.6.2: Primer sequences for the identification of 16s methylases with annealing temperature and product size

 

 

Genes Primers

Name Primers Sequence

(5’to 3′) Annealing temperature Product size References
armA armA-F ATTCTGCCTATCCTAATTGG 55°C 315-bp (Nie et al.,

2014)
armA-R ACCTATACTTTATCGTCGTC

 

 

 

 

 

3.S. peR products Sequencing and analysis

NanoDrop 2000c Spectrophotometer (Thermo Fisher Scientific Inc., USA) was used to quantify the amplified peR products after purification. For Sanger Sequencing, the eluted samples of DNA
were sent to Macrogen™ (Seoul, South Korea), The sequences of DNA obtained were evaluated

by the use of bioinformatics software, equipment, and servers.

 

 

 

 

CHAPTER 4

RESULTS

4.1. Characteristics of the Study Population

The conducted study based upon six months for the collection and the identification of A. baumannii mainly comprised of molecular characterization of A. baumannii and the role of armA for its resistance behavior to different antimicrobials. It includes 148 A. baumannii specimens obtained from 92 males and 56 females with 62% and 38% respectively belonging to different age groups. The age of the population ranges between 1 to 90 years with the mean age 51 years. The
isolates obtained from patients belonging to different age groups are: 05-39 years (n = 34), 40-60
(n = 55), 61-90 years (n = 56) and three isolates were from patients less than 05 years old.

 

 

4.2. Isolation and Identification of A. baumannii

The study was conducted in five tertiary care hospitals of Lahore and Faisalabad, Punjab, Pakistan. Different types of samples (blood, urine, wound pus etc.) were obtained from hospitalized patients. All samples were initially cultured on blood agar and MacConkey agar.
Following incubation, isolates were identified based on colony morphology, Gram’s staining, and
biochemical tests. All A. baumannii isolates showed yellow to golden color colonies with D- Hemolysis on the blood agar along with the yellow colonies on Mac agar (Figure 4.2.1), microscopic analysis after gram staining revealed no change in coloration , slide catalase test
showed bubble formation, clot formation was seen in tube catalase , DNA-ase test resulted in the clearing of zones around A. baumannii colonies, oxidase test showed negative results with the absence of color. Lack of motility observed by putting the semisolid agar in the test tube and stab-
line showed the margins in a straight way. Multiplex peR has been employed for further confirmation of A. baumannii. The specific primers employed in this process with the annealing temperatures has been given in table 4.2.1. armA has been confirmed by peR based technique using specific primers. The findings of antibiotic sensitivity of A. baumannii isolates against different antibiotics have been shown in Figure 4.8.1, whereas MIe values for amikacin and gentamicin through E-test are presented in table 4.10.1.

 

 

 

 

 

 

 

 

 

Figure.4.2.1 Acinetobacter colonies on MacConkey Agar

 

 

 

35
4.3. The occurrence of Acinetobacter baumannii

A total of 460 collected samples from hospitalized patients admitted in tertiary care hospitals of
Lahore named as; Mayo Hospital, Sheikh Zayed Hospital, Sir Ganga Ram Hospital, Children’s Hospital, Lahore and Services hospital Lahore were analyzed for the presence of A. baumannii. Of these (n=460) samples, only (n=218) specimens showed colonies on blood and MacConkey
agar. Whereas others (n=242) were negative or showed no growth. In (n=218) growth positive samples, A. baumannii were (n=148) whereas (n=70) were other bacteria (Table.4.3.2 and Figure.4.3.2).

 

 

 

 

 

 

 

 

 

Table 4.3.2: No. of A. baumannii and other Gram-negative Bacteria

Bacteria Number Percentage

 

A. baumannii 148 68%

 

Others 70 32%

 

Total 218 100%

 

4.4. Gender-based distribution of A. baumannii

Out of 148 A. baumannii positive hospitalized patients, 62% were male and 38% were isolated from females. Gender-wise analysis exhibited that the occurrence of A. baumannii was high in male patients (n=92), in comparison to female patients (n=56). The number of male patients infected with A. baumannii was also higher with a male to female ratio of 3:1 (Table. 4.4.1).

 

 

 

 

 

 

Table 4.4.1: Distribution of A. baumannii among male and female

 

 

Gender A. baumannii % age (n=148) Ratio

 

Female 56 38%

 

Male 92 62%

 

Grand Total 148 (100%) 100

3:1

 

 

 

 

 

 

38%

 

 

62%

 

Female Male

 

Figure.4.4.1: Gender based distribution of the A. baumannii isolates

 

4.5. Distribution of A. baumannii based on Sample Site

Based on the sampling site, the majority of A. baumannii were recovered from Tracheal secretions
(n=27), followed by pus 23, blood and sputum 21, CVP tip 12, wound swab 10, Foley’s tip and urine 8, ETT and fluid 5, bronchial washing 3, tissue and CSF 2 and only 1 from ear swab. Whereas no A. baumannii has been confirmed by urethral swab, stool semen and H.V.S (Table. 4.5.1 and
Figure.4.5.1).

 

Table 4.5.1. Distribution of A. baumannii among different samples

 

 

Specimens Acinetobacter Isolates
CVP Tip 12

Fluid
5

Urethral swab
0

Tissue
2

Foley’s Tip
8

Tracheal Secretion
27

ETT
5

Stool
0

Semen
0

Blood
21

Urine
8
Sputum 21

Throat Swab
0

Pus
23

Wound Swab
10

H.V. S
0

Bronchial Washing
3

CSF
2

Ear Swab
1
Total 148

 

 

 

 

20.00%

18.00%

18.20%

16.00%

14.00%

14.20%

14.20%

15.50%

12.00%

10.00%

8.00%

6.00%

8.10%

 

 

5.40%

 

 

5.40%

 

6.80%

4.00%

2.00%

0.00%

3.40%

 

1.40%

3.40%

2.00%

 

1.40%

 

0.70%

 

 

 

 

Figure 4.5.1 Percentage A. baumannii distribution among the sampling site
4.6. Age-based distribution of A. baumannii

Age-based analysis showed that the distribution of A. baumannii was highest (33%) in patients with an age group of 21-40 years. 32% among 41-60, 19% in 1-20-year-old patients and 16% in
61 to 90 years old patients.( Table 4.6.1) (Figure 4.6.1).
Table 4.6.1: Distribution of A. baumannii among different Age groups

Age groups No. Of A. baumannii

 

1-20 28 (19%)

 

21-40 49 (33%)

 

41-60 47 (32%)

 

61-90 24 (16%)

 

Grand total 148 (100%)
40%

 

32%

30%

25%

20%

19%

15%

16%

10%

5%

0%
1-20 years 21-40 years 41-60 years 61-90 years

 

Figure.4.6.1: Percentage distribution of the A. baumannii among various Age groups
4.7. Molecular characterization

The amplification of 16s rDNA was performed with the universal primers. The isolates of A. baumannii were further sequenced. Multiplex peR generated a fragment of 425 base pair of the recA gene found within species of Acinetobacter along with a 208 base pair fragment of the Internal transcribed region found in A. baumannii (fig.4.7.1)

 

 

 

 

 

 

Figure.4.7.1: Multiplex peR for the genus and specie level detection of A. baumannii

 

 

 

 

 

 

 

 

 

 

 

 

48
4.8. A. baumannii Antimicrobial Susceptibility profiles

All 148 isolates of A. baumannii were evaluated for antimicrobial sensitivity on Muller Hinton agar (Figure.4.8.1). All the isolates were 100% sensitive against Colistin as well as Tigecycline. A. baumannii isolates were found highly resistant against Cefepime (94.6%) followed by Meropenem, Ceftazidime, Cefotaxime and Ceftriaxone (93.9%) and least or no resistance was seen against Tigecycline and colistin (0.00%). The resistance pattern among other antimicrobials was Piperacillin-Tazobactam (92.6%), Ampicillin-Sulbactam and Ciprofloxacin (92.5%), Amikacin and Gentamicin (88.51%), Tobramycin(83.11%), Trimethoprim-Sulfamethoxazole (79.05%) and doxycycline (54.73%) (Table 4.8.1). Out of 148, 111 A. baumannii with armA has shown negative results, whereas 37 containing armA contributed high-level resistance in A.
baumannii against antibiotics. (figure.4.8.2a &4.8.2b&4.8.2c)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

49

 

 

Figure.4.8.1. Antibiogram of A. baumannii against various antibiotics

 

 

 

 

 

 

 

 

50

 

 

 

Table 4.8.1. Selected antimicrobial susceptibility profile of A. baumannii with armA

Antibiotics Sensitive Intermediate Resistance
Amikacin 17(11.49%) 0(0%) 131(88.51%)
Gentamicin 17(11.49%) 0(0%) 131(88.51%)
Tobramycin 25(16.89%) 0(0%) 123(83.11%)
armA 111(75%) 0(0%) 37(25%)
Meropenem 9(6.08%) 0(0%) 139(93.92%)
Ciprofloxacin 11(7.43%) 0(0%) 137(92.57%)
Piperacillin-
tazobactam 11(7.43%) 0(0%) 137(92.6%)
Cefepime 8(5.41%) 0(0%) 140(94.6%)
Cefotaxime 8(5.41%) 1(1%) 139(93.9%)
Ceftazidime 9(6.08%) 0(0%) 139(93.9%)
Ceftriaxone 8(5.41%) 1(1%) 139(93.9%)
Trimethoprim-
sulfamethoxazole 31(20.95%) 0(0%) 117(79.05%)
Ampicillin-sulbactam 8(5.41%) 3(2.02%) 137(92.57%)
Colistin 148(100%) 0(0%) 0(0%)
doxycycline 67(45.27%) 0(0%) 81(54.73%)
Tigecycline 147(99.32%) 1(1%) 0(0%)

 

 

 

 

 

 

51

 

Figure 4.S.2a. Antimicrobial sensitivity pattern of A. baumannii

 

 

 

 

 

 

 

 

 

 

 

 

52

 

 

120

Aibaumannii

 

100

 

80

 

60

 

40

 

20

 

0

 

 

 

 

Susceptible Resistant

 

Figure 4.8.2b: Comparison of Ai baumannii Antibiotic Susceptible/Resistance Pattern

 

100.00%

90.00%

80.00%

88.51%88.51%

 

83.11%

93.92%93.92%92.57%94.60%93.90%93.92%

 

 

79.05%

92.57%92.60%

70.00%

60.00%

54.73%

50.00%

40.00%

30.00%

20.00%

10.00%

0.00%

0.00%

0.00%

 

 

 

 

Resistant

 

Figure 4.S.2c. Antimicrobial Resistance pattern of A. baumannii against antimicrobials
4.9. Genetic Analysis of A. baumannii based on armA Gene

Presence of armA was confirmed using PeR. Amplified bands of A. baumannii were analyzed through agarose gel electrophoresis and visualized with the help of UV illuminator and amplified bands size was then compared with gene markers for the genetic confirmation of armA (Figure.4.9.1). eomparison with gene rule confirmed 315bp bands of armA gene.

Figure.4.9.1. Agarose Gel depicting bands of armA gene

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

56
4.10. Minimum inhibitory concentration (MIC)

MIC data analysis of Amikacin and Gentamicin showed that most of the A. baumannii isolates having more than 0.5 Minimum Inhibitory Concentrations are resistant to these antibiotics. 3% A. baumannii isolates were highly resistant with MIC >512. Whereas 19% and 18% against Amikacin and Gentamicin were resistant with MIC values 512. Complete MIC data for Amikacin and Gentamicin is shown in table.4.10.1. Standard values for MICs have been given in Table 4.10.2 according to the CLSI. MIC of armA positive isolates is shown in fig (4.10.1).

 

 

 

 

 

 

Table 4.10.1: MIC of A. baumannii against Amikacin and Gentamicin at various MIC

range

Antimicrobial
Agent Minimum Inhibitory Concentration
(µg/ml) Total
Isolates
0.5 1 2 4 8 16 32 64 128 256 512 >512
Amikacin 0 0 0 9 1 7 0 11 65 24 28 3 148
Gentamicin 1 8 4 4 0 10 19 39 31 8 24 0 148

Table: 4.10.2. Standard Values of minimal inhibitory concentrations (MICs) values according to CLSI 2014

 

 

Antibiotic code
Susceptible

AK
≤ 16

MEM
≤ 2

CIP
≤ 1

PIP
≤ 16

TZP
≤ 16/4

FEP
≤ 8

CAZ
≤ 8

SAM
≤ 8/4

ATM
≤ 4

CT
≤ 2

DO
≤ 4

SXT
≤ 2/38

 

 

 

 

 

 

 

 

 

31

 

24

 

 

 

 

5

o o o o o o o

 

 

o o o o

 

 

o o o o

8
6
4

o o 1
<o.5 1 2 4 8 16 32 64 128 256 >512

Amikacin Gentamicin

 

Figure.4.10.1: MIC of armA positive isolates

 

CHAPTER 5

Discussion

A. baumannii is the most reckless, non-spore forming, Gram-negative bacteria that causes a variety of infections to outdoor as well as indoor patients. Infections produced by A. baumannii leads to slow treatment through antibiotics making it resistant to most of the used antimicrobials. Infections become most difficult to treat and persistent when this bacterium acquires armA gene
by the horizontal gene transfer mechanism, Now it’s a major healthcare problem worldwide,

Taking into account the consequences of A. baumannii infections, the existing research was conducted with 5 main objectives: firstly, A. baumannii isolation and identification from numerous clinical specimens, 2nd was to confirm A. baumannii through disc diffusion assay, 3rd was to characterize A. baumannii on the basis of armA gene, 4th was to create phylogenetic tree of A. baumannii strains and lastly to study antimicrobial susceptibility profile against selected antimicrobials. The results of this study are expected to be helpful in the selection of appropriate antibiotic regimen for the management of invasive and difficult to treat infections of A. baumannii.

Initially, all isolates were cultured on the MacConkey agar along with the blood agar and as described by (Cheesbrough, 2006).Identification of A. baumannii was done by Gram staining showing no color change, catalase test showed bubble formation, clot formation in tubes of coagulase test and clearing of zones in DNA-ase test. Following biochemical identification, confirmation of A. baumannii was carried on by ribotyping as well as the Multiplexing assay using species-specific primers (Chen et al., 2007). The antibiotic sensitivity test was executed on the MHA. armA gene has been confirmed using specific primers with specific annealing temperatures according to the (Nie et al., 2014).

In hospitals, the number of A. baumannii cases changes from the area to area and from region to region. A. baumannii accounts for only <10% in some reports whereas higher percentage of A. baumannii is reported in many studies, 38% is documented by Bukhari et al. (2004) and 61% was reported by Hafiz et al. (2002). A developing rate of infections due to A. baumannii reported
by Pakistani workers in Pakistani hospitals and this increased prevalence of A. baumannii have been confirmed by many studies. The present study also reported up to 32% A. baumannii prevalence in major hospitals of Lahore.

On the basis of the sampling site, the highest percentage of A. baumannii was isolated from tracheal secretion (19%) followed by pus samples (16%), and blood (15%). The highest rate of A. baumannii from tracheal secretion samples could be due to the large sample size of tracheal infections. The overall prevalence of the A. baumannii was higher in Sheikh Zayed hospital Lahore in comparison to other hospitals. This difference could be due to hospital infection control policy and treatment of the patients.

Based on the gender, A. baumannii prevalence was reported greater in males (62%) than in females (38%). The prevalence of A. baumannii in all age groups was higher between 21-60 years old patients. A. baumannii occurrence was observed to be higher in 21-40 years (33%) age group accompanied by the 41-60 years (32%), 1-20 years (19%) as well as 61-90 years (15%). The major basis for the greater occurrence rate of A. baumannii among males in Pakistan can be: since most males are exposed to environmental hazards because of the high proportion of males are in outside work.

The responsible gene for the antibiotic resistance against all antibiotics was proved with the help of PCR. In the existed study all A. baumannii isolates were selected for the genetic analysis on the basis of the recA gene, using a specific set of forward and reverse primers. The recA gene was detected among all isolates. Various microbiological techniques have been utilized for the selective isolation of A. baumannii by disc diffusion assay but genetic detection of recA is the gold standard.

Antimicrobial sensitivity of all isolates of A. baumannii was carried out on Mueller Hinton agar plates through the disc diffusion technique and results were interpreted using CLSI guidelines. Antimicrobial susceptibility data showed highly variable resistance pattern of A. baumannii isolates. Colistin and Tigecycline were found to be the drug of choice against all A. baumannii isolates. All A. baumannii isolates were found to be sensitive against oxacillin, cefepime, cefoperazone, cefotaxime, cefoxitin, cefuroxime, ceftazidime, ceftriaxone, cephalexin,
cephradine, cefaclor, cefixime, imipenem, meropenem, sulbactam, amikacin, colistin and doxycycline to various extent. A. baumannii isolates were found highly resistant against cefepime (94.6%) and least resistance was seen against doxycycline (54%). The resistance pattern among other antimicrobials is as meropenem, cefotaxime, and ceftriaxone (93.9%), Piperacillin- Tazobactam (92.6%), ciprofloxacin and Ampicillin-Sulbactam (92.5%), amikacin and gentamicin (88.5%) and Trimethoprim-Sulfamethoxazole (79%). Considering the overall results of the present study, it was concluded that A. baumannii accounts high-level infections mostly to male patients with 21-40 years of age are more prone to its infections. Moreover, both phenotypic (Latex agglutination) and genotypic (PCR) tools were found significant for the detection of A. baumannii. Colistin along with Tigecycline was found the most effective antibiotics against the A. baumannii, as all the isolates of A. baumannii were found sensitive to them.
SUMMARY

Acinetobacter baumannii belong to the gram-negative bacteria, developed high resistance against the present useful antimicrobials thereby established a serious threat to infections caused by it. The pathogen mainly attacked on I’U patients having a weak immunity system. Its flexible
genome making it sprightful in dodging the used antimicrobials of now a day, That’s why it is now

been labeled as multidrug-resistant (MDR) to extensive drug resistant (XDR).

A. baumannii is the major reason for many invasive soft infections that sometimes leads to morbidity and mortality. No. of factors found responsible for the increase of A. baumannii infections in the developing world like poverty, poor hygiene, lack of awareness and self- medication and direct contact with a colonized carrier or diseased patients. A. baumannii is more prevalent in hospital-acquired infections. Approximately one forth hospital-acquired infections are due to A. baumannii.

The present study aimed to isolate, identify and molecularly characterize A. baumannii, to investigate the presence of armA 16S rRNA Methylase that produces antibiotic. For isolation and Identification of A. baumannii, 460 clinical samples were initially cultured on blood agar and
MacConkey’s agar, Gram stained and tested for the presence of catalase, coagulase and DNA-ase

enzyme. Genetic confirmation of A. baumannii was completed through specific amplification of

recA by p’R.

The prevalence of A. baumannii among isolated bacteria was 68%. Higher rates of A. baumannii were found in (21-40yrs) age group (33%), male patients (62%) and Tracheal secretion (23%). Genetic analysis revealed the presence of the recA gene in all phenotypically confirmed isolates of A. baumannii.
Antibiotic sensitivity profile was carried out through the Kirby-Bauer technique on MHA by using CLSI guidelines. Most of the A. baumannii isolates showed resistance against antimicrobials in the variable pattern except colistin and tigecycline. Maximum resistance was found against Cefepime (94.6%) while least was found against tobramycin (55%) while no resistance was detected against Colistin and Tigecycline. MIC values of two important antimicrobials showed 28 isolates against Amikacin and 24 isolates against Gentamicin are a resistant category with MICs
512 while 3 of the isolates with MIC >512 against Amikacin revealed it as a highly resistant bug.

Among 148 A. baumannii, armA containing was (25%) observed to be highly resistant against antibiotics except for Colistin and Tigecycline while armA also found in susceptible isolates of (75%), showed no resistance.

In conclusion, A. baumannii is a significant hospital pathogen with different adaptive strategies to cause infection and antibiotic resistance. Due to higher resistance capability, it is of great concern to the physician to identify its prevailing purpose, that infects many patients and coerces them to keep visiting hospitals in order to get rid of it. Some of the risk factors included poor hygienic measures, sanitary problems and use of antibiotics again and again. However, with a better understanding of pathogen, it will be helpful in controlling the spreading of infections and the development of new antimicrobials.
References

Aghazadeh, M., Rezaee, M. A., Nahaei, M. R., Mahdian, R., Pajand, 0., Saffari, F., . . . Hojabri, Z. (2013). Dissemination of aminoglycoside-modifying enzymes and 16S rRNA methylases among acinetobacter baumannii and Pseudomonas aeruginosa isolates. Microb Drug Resist, 19(4), 282-288. doi: 10.1089/mdr.2012.0223
Akers, K. S., Chaney, C., Barsoumian, A., Beckius, M., Zera, W., Yu, X., . . . Murray, C. K. (2010).

Aminoglycoside resistance and susceptibility testing errors in Acinetobacter baumannii- calcoaceticus complex. J Clin Microbiol, 48(4), 1132-1138. doi: 10.1128/jcm.02006-09
Aliakbarzade, K., Farajnia, S., Karimi Nik, A., Zarei, F., & Tanomand, A. (2014). Prevalence of Aminoglycoside Resistance Genes in Acinetobacter baumannii Isolates. Jundishapur J Microbiol, 7(10), e11924. doi: 10.5812/jjm.11924
Anstey, N. M., Currie, B. J., & Withnall, K. M. (1992). Community-Acquired Acinetobacter

Pneumonia in the Northern Territory of Australia. Clinical In!ectious Diseases, 14(1), 83-

91. doi: 10.1093/clinids/14.1.83

Arciola, C. R., Campoccia, D., Speziale, P., Montanaro, L., & Costerton, J. W. (2012). Biofilm formation in Staphylococcus implant infections. A review of molecular mechanisms and implications for biofilm-resistant materials. Biomaterials, 33(26), 5967-5982. doi:
10.1016/j.biomaterials.2012.05.031

Asif, M., Alvi, I., & Rehman, S. (2018). Insight into Acinetobacter baumannii ” pathogenesis, global resistance, mechanisms o! resistance, treatment options, and alternative modalities (Vol. Volume 11).
Atasoy, A. R., Ciftci, I. H., & Petek, M. (2015). Modifying enzymes related aminoglycoside:

analyses of resistant Acinetobacter isolates. Int J Clin Exp Med, 8(2), 2874-2880.

Bakour, S., Touati, A., Bachiri, T., Sahli, F., Tiouit, D., Naim, M., . . . Rolain, J. M. (2014). First report of 16S rRNA methylase ArmA-producing Acinetobacter baumannii and rapid spread of metallo-beta-lactamase NDM-1 in Algerian hospitals. J In!ect Chemother,
20(11), 696-701. doi: 10.1016/j.jiac.2014.07.010

Begum, S., Hasan, F., Hussain, S., & Ali Shah, A. (2013). Prevalence of multi drug resistant Acinetobacter baumannii in the clinical samples from Tertiary Care Hospital in Islamabad, Pakistan. Pak J Med Sci, 29(5), 1253-1258.
Bergogne-Berezin, E., & Towner, K. J. (1996). Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin Microbiol Rev, 9(2), 148-165. Bogaerts, P., Galimand, M., Bauraing, C., Deplano, A., Vanhoof, R., De Mendonca, R., . . . Glupczynski, Y. (2007). Emergence of ArmA and RmtB aminoglycoside resistance 16S
rRNA methylases in Belgium. J Antimicrob Chemother, 59(3), 459-464. doi:

10.1093/jac/dkl527

Bonnin, R. A., Cuzon, G., Poirel, L., & Nordmann, P. (2013). Multidrug-resistant Acinetobacter baumannii clone, France. Emerg Infect Dis, 19(5), 822-823. doi: 10.3201/eid1905.121618
Brotfain, E., Borer, A., Koyfman, L., Saidel-Odes, L., Frenkel, A., Gruenbaum, S. E., . . . Klein, M. (2016). Multidrug Resistance Acinetobacter Bacteremia Secondary to Ventilator- Associated Pneumonia: Risk Factors and Outcome. J Intensive Care Med. doi:
10.1177/0885066616632193

Cerqueira, G. M., & Peleg, A. Y. (2011). Insights into Acinetobacter baumannii pathogenicity.

IUBMB Life, 63(12), 1055-1060. doi: 10.1002/iub.533

Charfi-Kessis, K., Mansour, W., Ben Raj Khalifa, A., Mastouri, M., Nordmann, P., Aouni, M., & Poirel, L. (2014). Multidrug-resistant Acinetobacter baumannii strains carrying the bla(OxA-23) and the bla(GES-11) genes in a neonatology center in Tunisia. Microb Pathog, 74, 20-24. doi: 10.1016/j.micpath.2014.07.003
Chastre, J. (2003). Infections due to Acinetobacter baumannii in the ICU. Semin Respir Crit Care

Med, 24(1), 69-78. doi: 10.1055/s-2003-37918

Cheesbrough, M. (2006). District laboratory practice in tropical countries: Cambridge university press.
Chen, T. L., Siu, L. K., Wu, R. C., Shaio, M. F., Ruang, L. Y., Fung, C. P., . . . Cho, W. L. (2007).

Comparison of one-tube multiplex PCR, automated ribotyping and intergenic spacer (ITS)

sequencing for rapid identification of Acinetobacter baumannii. Clin Microbiol Infect,

13(8), 801-806. doi: 10.1111/j.1469-0691.2007.01744.x

Chin, C. Y., Gregg, K. A., Napier, B. A., Ernst, R. K., & Weiss, D. S. (2015). A PmrB-Regulated Deacetylase Required for Lipid A Modification and Polymyxin Resistance in Acinetobacter baumannii. Antimicrob Agents Chemother, 59(12), 7911-7914. doi:
10.1128/aac.00515-15
Cho, Y. J., Moon, D. C., Jin, J. S., Choi, C. R., Lee, Y. C., & Lee, J. C. (2009). Genetic basis of resistance to aminoglycosides in Acinetobacter spp. and spread of armA in Acinetobacter baumannii sequence group 1 in Korean hospitals. Diagn Microbiol In!ect Dis, 64(2), 185-
190. doi: 10.1016/j.diagmicrobio.2009.02.010

Choi, C. R., Lee, E. Y., Lee, Y. C., Park, T. I., Kim, R. J., Ryun, S. R., . . . Lee, J. C. (2005). Outer membrane protein 38 of Acinetobacter baumannii localizes to the mitochondria and induces apoptosis of epithelial cells. Cell Microbiol, 7(8), 1127-1138. doi: 10.1111/j.1462-
5822.2005.00538.x

Chopra, I., & Roberts, M. (2001). Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev, 65(2), 232-260
; second page, table of contents. doi: 10.1128/mmbr.65.2.232-260.2001

Cisneros, J. M., & Rodriguez-Bano, J. (2002). Nosocomial bacteremia due to Acinetobacter baumannii: epidemiology, clinical features and treatment. Clin Microbiol In!ect, 8(11),
687-693.

Clark, N. M., Zhanel, G. G., & Lynch, J. P., 3rd. (2016). Emergence of antimicrobial resistance among Acinetobacter species: a global threat. Curr 0pin Crit Care, 22(5), 491-499. doi:
10.1097/mcc.0000000000000337

CLSI. (2014). Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fourth Informational Supplement. M100- S24. Wayne, PA, USA. .
Costello, S. E., Deshpande, L. M., Davis, A. P., Mendes, R. E., & Castanheira, M. (2019).

Aminoglycoside-modifying enzyme and 16S ribosomal RNA methyltransferase genes among a global collection of Gram-negative isolates. J Glob Antimicrob Resist, 16, 278-
285. doi: 10.1016/j.jgar.2018.10.020

Coyne, S., Courvalin, P., & Perichon, B. (2011). Efflux-mediated antibiotic resistance in

Acinetobacter spp. Antimicrob Agents Chemother, 55(3), 947-953. doi:

10.1128/aac.01388-10

Dalla-Costa, L. M., Coelho, J. M., Souza, R. A., Castro, M. E., Stier, C. J., Bragagnolo, K. L., . . .

Woodford, N. (2003). Outbreak of carbapenem-resistant Acinetobacter baumannii producing the OXA-23 enzyme in Curitiba, Brazil. J Clin Microbiol, 41(7), 3403-3406.
Davis, K. A., Moran, K. A., McAllister, C. K., & Gray, P. J. (2005). Multidrug-resistant

Acinetobacter extremity infections in soldiers. Emerg In!eet Dis, 11(8), 1218-1224. doi:

10.3201/eid1108.050103

Dent, L. L., Marshall, D. R., Pratap, S., & Hulette, R. B. (2010). Multidrug resistant Acinetobacter baumannii: a descriptive study in a city hospital. BMC In!eet Dis, 10, 196. doi:
10.1186/1471-2334-10-196

Devaud, M., Kayser, F. H., & Bachi, B. (1982). Transposon-mediated multiple antibiotic resistance in Acinetobacter strains. Antimierob Agents Chemother, 22(2), 323-329.
Dijkshoorn, L., Nemec, A., & Seifert, H. (2007). An increasing threat in hospitals: multidrug- resistant Acinetobacter baumannii. Nat Rev Mierobiol, 5(12), 939-951. doi:
10.1038/nrmicro1789

Doi, Y., Adams, J. M., Yamane, K., & Paterson, D. L. (2007). Identification of 16S rRNA methylase-producing Acinetobacter baumannii clinical strains in North America. Antimierob Agents Chemother, 51(11), 4209-4210. doi: 10.1128/AAC.00560-07
Doi, Y., & Arakawa, Y. (2007). 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides. Clin In!eet Dis, 45(1), 88-94. doi: 10.1086/518605
Doi, Y., Murray, G. L., & Peleg, A. Y. (2015). Acinetobacter baumannii: evolution of antimicrobial resistance-treatment options. Semin Respir Crit Care Med, 36(1), 85-98. doi:
10.1055/s-0034-1398388

Doi, Y., Wachino, J., & Arakawa, Y. (2008). Nomenclature of plasmid-mediated 16S rRNA

methylases responsible for panaminoglycoside resistance. Antimierob Agents Chemother,

52(6), 2287-2288. doi: 10.1128/aac.00022-08

Donlan, R. M. (2002). Biofilms: microbial life on surfaces. Emerg In!eet Dis, 8(9), 881-890. doi:

10.3201/eid0809.020063

Espinal, P., Marti, S., & Vila, J. (2012). Effect of biofilm formation on the survival of

Acinetobacter baumannii on dry surfaces. J Hosp In!eet, 80(1), 56-60. doi:

10.1016/j.jhin.2011.08.013

Evans, B. A., Hamouda, A., Abbasi, S. A., Khan, F. A., & Amyes, S. G. (2011). High prevalence of unrelated multidrug-resistant Acinetobacter baumannii isolates in Pakistani military hospitals. Int J Antimierob Agents, 37(6), 580-581. doi: 10.1016/j.ijantimicag.2011.01.023
Falagas, M. E., Koletsi, P. K., & Bliziotis, I. A. (2006). The diversity of definitions of multidrug- resistant (MDR) and pandrug-resistant (PDR) Acinetobacter baumannii and Pseudomonas aeruginosa. J Med Microbiol, 55(Pt 12), 1619-1629. doi: 10.1099/jmm.0.46747-0
Falagas, M. E., Mourtzoukou, E. G., Polemis, M., Vatopoulos, A. C., & Greek System for Surveillance of Antimicrobial, R. (2007). Trends in antimicrobial resistance of Acinetobacter baumannii clinical isolates from hospitalised patients in Greece and treatment implications. Clin Microbiol In!ect, 13(8), 816-819. doi: 10.1111/j.1469-
0691.2007.01761.x

Fauci, A. S., Touchette, N. A., & Folkers, G. K. (2005). Emerging infectious diseases: a 10-year perspective from the National Institute of Allergy and Infectious Diseases. Emerg In!ect Dis, 11(4), 519-525. doi: 10.3201/eid1104.041167
Fishbain, J., & Peleg, A. Y. (2010). Treatment of Acinetobacter infections. Clin In!ect Dis, 51(1),

79-84. doi: 10.1086/653120

Forbes, B., Sahm, D., Weissfeld, A., & Bailey, S. s. (2007). Diagnostic microbiology 12th Edition: Mosby Elsevier, St Louis, MO.
Fournier, P. E., & Richet, H. (2006). The epidemiology and control of Acinetobacter baumannii in health care facilities. Clin In!ect Dis, 42(5), 692-699. doi: 10.1086/500202
Fournier, P. E., Richet, H., & Weinstein, R. A. (2006). The Epidemiology and Control of

Acinetobacter baumannii in Health Care Facilities. Clinical In!ectious Diseases, 42(5),

692-699. doi: 10.1086/500202

Fritsche, T. R., Castanheira, M., Miller, G. H., Jones, R. N., & Armstrong, E. S. (2008). Detection of methyltransferases conferring high-level resistance to aminoglycosides in enterobacteriaceae from Europe, North America, and Latin America. Antimicrob Agents Chemother, 52(5), 1843-1845. doi: 10.1128/aac.01477-07
Gaddy, J. A., & Actis, L. A. (2009). Regulation of Acinetobacter baumannii biofilm formation.

Future Microbiol, 4(3), 273-278. doi: 10.2217/fmb.09.5

Gaddy, J. A., Tomaras, A. P., & Actis, L. A. (2009). The <em>Acinetobacter baumannii</em>

19606 OmpA Protein Plays a Role in Biofilm Formation on Abiotic Surfaces and in the

Interaction of This Pathogen with Eukaryotic Cells. In!ection and Immunity, 77(8), 3150-

3160. doi: 10.1128/iai.00096-09
Galimand, M., Courvalin, P., & Lambert, T. (2003). Plasmid-mediated high-level resistance to aminoglycosides in Enterobacteriaceae due to 16S rRNA methylation. Antimicrob Agents Chemother, 47(8), 2565-2571.
Galimand, M., Sabtcheva, S., Courvalin, P., & Lambert, T. (2005). Worldwide disseminated armA aminoglycoside resistance methylase gene is borne by composite transposon Tn1548. Antimicrob Agents Chemother, 49(7), 2949-2953. doi: 10.1128/aac.49.7.2949-2953.2005
Garnacho-Montero, J., Amaya-Villar, R., Ferrandiz-Millon, C., Diaz-Martin, A., Lopez-Sanchez, J. M., & Gutierrez-Pizarraya, A. (2015). Optimum treatment strategies for carbapenem- resistant Acinetobacter baumannii bacteremia. Expert Rev Anti In!ect Ther, 13(6), 769-777. doi: 10.1586/14787210.2015.1032254
Garnacho-Montero, J., Gutierrez-Pizarraya, A., Diaz-Martin, A., Cisneros-Herreros, J. M., Cano, M. E., Gato, E., . . . Rodriguez-Bano, J. (2016). Acinetobacter baumannii in critically ill patients: Molecular epidemiology, clinical features and predictors of mortality. En!erm In!ecc Microbiol Clin, 34(9), 551-558. doi: 10.1016/j.eimc.2015.11.018
Hanberger, H., Garcia-Rodriguez, J. A., Gobernado, M., Goossens, H., Nilsson, L. E., & Struelens, M. J. (1999). Antibiotic susceptibility among aerobic gram-negative bacilli in intensive care units in 5 European countries. French and Portuguese ICU Study Groups. JAMA,
281(1), 67-71.

He, X., Lu, F., Yuan, F., Jiang, D., Zhao, P., Zhu, J., . . . Lu, G. (2015). Biofilm Formation Caused by Clinical Acinetobacter baumannii Isolates Is Associated with Overexpression of the AdeFGH Efflux Pump. Antimicrob Agents Chemother, 59(8), 4817-4825. doi:
10.1128/aac.00877-15

Huang, J., Ye, M., Jia, x., Yu, F., & Wang, M. (2019). Coexistence o! armA and genes encoding aminoglycoside-modi!ying enzymes in Acinetobacter baumannii.
Jain, R., & Danziger, L. H. (2004). Multidrug-resistant Acinetobacter infections: an emerging challenge to clinicians. Ann Pharmacother, 38(9), 1449-1459. doi: 10.1345/aph.1D592
Jawad, A., Heritage, J., Snelling, A. M., Gascoyne-Binzi, D. M., & Hawkey, P. M. (1996).

Influence of relative humidity and suspending menstrua on survival of Acinetobacter spp. on dry surfaces. J Clin Microbiol, 34(12), 2881-2887.
Joly-Guillou, M. L. (2005). Clinical impact and pathogenicity of Acinetobacter. Clin Microbiol

In!ect, 11(11), 868-873. doi: 10.1111/j.1469-0691.2005.01227.x
Kaleem, F., Usman, J., Rassan, A., & Khan, A. (2010). Frequency and susceptibility pattern of metallo-beta-lactamase producers in a hospital in Pakistan. J In!eet Dev Ctries, 4(12), 810-
813.

Khatri, 1., Singh, N. K., Subramanian, S., & Mayilraj, S. (2014). Genome sequencing and annotation of Acinetobacter junii strain MTCC 11364. Genom Data, 2, 13-15. doi:
10.1016/j.gdata.2013.10.005

Kim, J. W., Reo, S. T., Jin, J. S., Choi, C. R., Lee, Y. C., Jeong, Y. G., . . . Lee, J. C. (2008).

Characterization of Acinetobacter baumannii carrying bla(OXA-23), bla(PER-1) and armA in a Korean hospital. Clin Mierobiol In!eet, 14(7), 716-718. doi: 10.1111/j.1469-
0691.2008.02022.x

Kojic, M., Topisirovic, L., & Vasiljevic, B. (1996). Translational autoregulation of the sgm gene from Micromonospora zionensis. J Baeteriol, 178(18), 5493-5498.
Krause, K. M., Serio, A. W., Kane, T. R., & Connolly, L. E. (2016). Aminoglycosides: An

Overview. Cold Spring Harb Perspeet Med, 6(6). doi: 10.1101/cshperspect.a027029

Leclercq, R., Canton, R., Brown, D. F., Giske, C. G., Reisig, P., MacGowan, A. P., . . . Kahlmeter, G. (2013). EUCAST expert rules in antimicrobial susceptibility testing. Clin Mierobiol In!eet, 19(2), 141-160. doi: 10.1111/j.1469-0691.2011.03703.x
Lee, R., Yong, D., Yum, J. R., Roh, K. R., Lee, K., Yamane, K., . . . Chong, Y. (2006).

Dissemination of 16S rRNA methylase-mediated highly amikacin-resistant isolates of

Klebsiella pneumoniae and Acinetobacter baumannii in Korea. Diagn Mierobiol In!eet Dis,

56(3), 305-312. doi: 10.1016/j.diagmicrobio.2006.05.002

Lee, K., Kim, M. N., Kim, J. S., Rong, R. L., Kang, J. O., Shin, J. R., . . . Chong, Y. (2011).

Further increases in carbapenem-, amikacin-, and fluoroquinolone-resistant isolates of

Acinetobacter spp. and P. aeruginosa in Korea: KONSAR study 2009. Yonsei Med J, 52(5),

793-802. doi: 10.3349/ymj.2011.52.5.793

Leite, G. C., Oliveira, M. S., Perdigao-Neto, L. V., Rocha, C. K., Guimaraes, T., Rizek, C., . . .

Costa, S. F. (2016). Antimicrobial Combinations against Pan-Resistant Acinetobacter baumannii 1solates with Different Resistance Mechanisms. PLoS One, 11(3), e0151270. doi: 10.1371/journal.pone.0151270
Lin, M. F., & Lan, C. Y. (2014). Antimicrobial resistance in Acinetobacter baumannii: From bench to bedside. World J Clin Cases, 2(12), 787-814. doi: 10.12998/wjcc.v2.i12.787
Liu, Q., Li, W., Du, X., Li, W., Zhong, T., Tang, Y., . . . Xie, Y. (2015). Risk and Prognostic Factors for Multidrug-Resistant Acinetobacter Baumannii Complex Bacteremia: A Retrospective Study in a Tertiary Hospital of West China. PLoS One, 10(6), e0130701. doi: 10.1371/journal.pone.0130701
Liu, Y. H., Kuo, S. C., Lee, Y. T., Chang, 1. C., Yang, S. P., Chen, T. L., & Fung, C. P. (2012).

Amino acid substitutions of quinolone resistance determining regions in GyrA and ParC associated with quinolone resistance in Acinetobacter baumannii and Acinetobacter genomic species 13TU. J Microbiol Immunol In!ect, 45(2), 108-112. doi:
10.1016/j.jmii.2011.09.001

Magiorakos, A.-P., Srinivasan, A., Carey, R., Carmeli, Y., Falagas, M., Giske, C., . . . Olsson- Liljequist, B. (2012). Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clinical microbiology and in!ection, 18(3), 268-281.
Magiorakos, A. P., Srinivasan, A., Carey, R. B., Carmeli, Y., Falagas, M. E., Giske, C. G., . . .

Monnet, D. L. (2012). Multidrug-resistant, extensively drug-resistant and pandrug- resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol In!ect, 18(3), 268-281. doi: 10.1111/j.1469-
0691.2011.03570.x

Magnet, S., Courvalin, P., & Lambert, T. (2001). Resistance-nodulation-cell division-type efflux pump involved in aminoglycoside resistance in Acinetobacter baumannii strain BM4454. Antimicrob Agents Chemother, 45(12), 3375-3380. doi: 10.1128/aac.45.12.3375-
3380.2001

Mak, J. K., Kim, M. J., Pham, J., Tapsall, J., & White, P. A. (2009). Antibiotic resistance determinants in nosocomial strains of multidrug-resistant Acinetobacter baumannii. J Antimicrob Chemother, 63(1), 47-54. doi: 10.1093/jac/dkn454
Manchanda, V., Sanchaita, S., & Singh, N. (2010). Multidrug resistant acinetobacter. J Glob In!ect

Dis, 2(3), 291-304. doi: 10.4103/0974-777X.68538

McConnell, M. J., Actis, L., & Pachon, J. (2013). Acinetobacter baumannii: human infections, factors contributing to pathogenesis and animal models. FEMS Microbiol Rev, 37(2), 130-
155. doi: 10.1111/j.1574-6976.2012.00344.x
McQueary, C. N., Kirkup, B. C., Si, Y., Barlow, M., Actis, L. A., Craft, D. W., & Zurawski, D. V. (2012). Extracellular stress and lipopolysaccharide modulate Acinetobacter baumannii surface-associated motility. J Microbiol, 50(3), 434-443. doi: 10.1007/s12275-012-1555-1
Meletis, G. (2016). Carbapenem resistance: overview of the problem and future perspectives. Ther

Adv In!ect Dis, 3(1), 15-21. doi: 10.1177/2049936115621709

Merino, M., Poza, M., Roca, I., Barba, M. J., Sousa, M. D., Vila, J., & Bou, G. (2014). Nosocomial outbreak of a multiresistant Acinetobacter baumannii expressing OXA-23 carbapenemase in Spain. Microb Drug Resist, 20(4), 259-263. doi: 10.1089/mdr.2013.0127
Milan, A., Furlanis, L., Cian, F., Bressan, R., Luzzati, R., Lagatolla, C., . . . Dolzani, L. (2016).

Epidemic Dissemination of a Carbapenem-Resistant Acinetobacter baumannii Clone Carrying armA Two Years After Its First Isolation in an Italian Hospital. Microb Drug Resist, 22(8), 668-674. doi: 10.1089/mdr.2015.0167
Moniri, R., Farahani, R. K., Shajari, G., Shirazi, M. N., & Ghasemi, A. (2010). Molecular epidemiology of aminoglycosides resistance in acinetobacter spp. With emergence of multidrug-resistant strains. Iran J Public Health, 39(2), 63-68.
Montefour, K., Frieden, J., Hurst, S., Helmich, C., Headley, D., Martin, M., & Boyle, D. A. (2008).

Acinetobacter baumannii: an emerging multidrug-resistant pathogen in critical care. Crit

Care Nurse, 28(1), 15-25; quiz 26.

Naas, T., Namdari, F., Reglier-Poupet, H., Poyart, C., & Nordmann, P. (2007). Panresistant extended-spectrum beta-lactamase SHV-5-producing Acinetobacter baumannii from New York City. J Antimicrob Chemother, 60(5), 1174-1176. doi: 10.1093/jac/dkm366
Nie, L., Lv, Y., Yuan, M., Hu, X., Nie, T., Yang, X., . . . You, X. (2014). Genetic basis of high level aminoglycoside resistance in Acinetobacter baumannii from Beijing, China. Acta Pharm Sin B, 4(4), 295-300. doi: 10.1016/j.apsb.2014.06.004
Ong, C. W., Lye, D. C., Khoo, K. L., Chua, G. S., Yeoh, S. F., Leo, Y. S., . . . Chua, A. C. (2009).

Severe community-acquired Acinetobacter baumannii pneumonia: an emerging highly lethal infectious disease in the Asia-Pacific. Respirology, 14(8), 1200-1205. doi:
10.1111/j.1440-1843.2009.01630.x

Opazo, A., Dominguez, M., Bello, H., Amyes, S. G., & Gonzalez-Rocha, G. (2012). OXA-type carbapenemases in Acinetobacter baumannii in South America. J In!ect Dev Ctries, 6(4),
311-316.
Ozaki, T., Nishimura, N., Arakawa, Y., Suzuki, M., Narita, A., Yamamoto, Y., . . . Funahashi, K. (2009). Community-acquired Acinetobacter baumannii meningitis in a previously healthy
14-month-old boy. J In!ect Chemother, 15(5), 322-324. doi: 10.1007/s10156-009-0704-x

Pantophlet, R., Brade, L., & Brade, H. (1999). Identification of Acinetobacter baumannii strains with monoclonal antibodies against the O antigens of their lipopolysaccharides. Clin Diagn Lab Immunol, 6(3), 323-329.
Peleg, A. Y., & Hooper, D. C. (2010). Hospital-acquired infections due to gram-negative bacteria.

N Engl J Med, 362(19), 1804-1813. doi: 10.1056/NEJMra0904124

Peleg, A. Y., Seifert, H., & Paterson, D. L. (2008). Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev, 21(3), 538-582. doi: 10.1128/CMR.00058-07
Peleg, A. Y., Seifert, H., & Paterson, D. L. (2008). <em>Acinetobacter baumannii</em>: Emergence of a Successful Pathogen. Clinical Microbiology Reviews, 21(3), 538-582. doi:
10.1128/cmr.00058-07

Peng, C., Zong, Z., & Fan, H. (2012). Acinetobacter baumannii isolates associated with community-acquired pneumonia in West China. Clin Microbiol In!ect, 18(12), E491-493. doi: 10.1111/1469-0691.12017
Perez, F., Hujer, A. M., Hujer, K. M., Decker, B. K., Rather, P. N., & Bonomo, R. A. (2007).

Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob Agents

Chemother, 51(10), 3471-3484. doi: 10.1128/AAC.01464-06

Poole, K. (2005). Efflux-mediated antimicrobial resistance. J Antimicrob Chemother, 56(1), 20-

51. doi: 10.1093/jac/dki171

Roca, I., Espinal, P., Vila-Farres, X., & Vila, J. (2012). The Acinetobacter baumannii Oxymoron: Commensal Hospital Dweller Turned Pan-Drug-Resistant Menace. Front Microbiol, 3,
148. doi: 10.3389/fmicb.2012.00148

Rodriguez-Bano, J., Garcia, L., Ramirez, E., Martinez-Martinez, L., Muniain, M. A., Fernandez- Cuenca, F., . . . Pascual, A. (2009). Long-term control of hospital-wide, endemic multidrug- resistant Acinetobacter baumannii through a comprehensive “bundle” approach. Am J In!ect Control, 37(9), 715-722. doi: 10.1016/j.ajic.2009.01.008
Sebeny, P. J., Riddle, M. S., & Petersen, K. (2008). Acinetobacter baumannii skin and soft-tissue infection associated with war trauma. Clin In!ect Dis, 47(4), 444-449. doi: 10.1086/590568
Seifert, R., Baginski, R., Schulze, A., & Pulverer, G. (1993). Antimicrobial susceptibility of

Acinetobacter species. Antimicrob Agents Chemother, 37(4), 750-753.

Seifert, R., Dijkshoorn, L., Gerner-Smidt, P., Pelzer, N., Tjernberg, I., & Vaneechoutte, M. (1997).

Distribution of Acinetobacter species on human skin: comparison of phenotypic and genotypic identification methods. J Clin Microbiol, 35(11), 2819-2825.
Sengupta, S., Kumar, P., Ciraj, A. M., & Shivananda, P. G. (2001). Acinetobacter baumannii–an emerging nosocomial pathogen in the burns unit Manipal, India. Burns, 27(2), 140-144.
Sheikhalizadeh, V., Rasani, A., Ahangarzadeh Rezaee, M., Rahmati-Yamchi, M., Rasani, A., Ghotaslou, R., & Goli, R. R. (2017). Comprehensive study to investigate the role of various aminoglycoside resistance mechanisms in clinical isolates of Acinetobacter baumannii. J In!ect Chemother, 23(2), 74-79. doi: 10.1016/j.jiac.2016.09.012
Sinha, M., Srinivasa, R., & Macaden, R. (2007). Antibiotic resistance profile & extended spectrum beta-lactamase (ESBL) production in Acinetobacter species. Indian J Med Res, 126(1), 63-
67.

Strateva, T., Markova, B., Marteva-Proevska, Y., Ivanova, D., & Mitov, I. (2012). Widespread dissemination of multidrug-resistant Acinetobacter baumannii producing OXA-23 carbapenemase and ArmA 16S ribosomal RNA methylase in a Bulgarian university hospital. Braz J In!ect Dis, 16(3), 307-310.
Tada, T., Miyoshi-Akiyama, T., Shimada, K., Shimojima, M., & Kirikae, T. (2014). Dissemination of 16S rRNA methylase ArmA-producing acinetobacter baumannii and emergence of OXA-72 carbapenemase coproducers in Japan. Antimicrob Agents Chemother, 58(5),
2916-2920. doi: 10.1128/aac.01212-13

Talbot, G. R., Bradley, J., Edwards, J. E., Jr., Gilbert, D., Scheld, M., & Bartlett, J. G. (2006). Bad bugs need drugs: an update on the development pipeline from the Antimicrobial Availability Task Force of the Infectious Diseases Society of America. Clin In!ect Dis,
42(5), 657-668. doi: 10.1086/499819

Tankovic, J., Legrand, P., De Gatines, G., Chemineau, V., Brun-Buisson, C., & Duval, J. (1994).

Characterization of a hospital outbreak of imipenem-resistant Acinetobacter baumannii by phenotypic and genotypic typing methods. J Clin Microbiol, 32(11), 2677-2681.
Tomaras, A. P., Dorsey, C. W., Edelmann, R. E., & Actis, L. A. (2003). Attachment to and biofilm formation on abiotic surfaces by Acinetobacter baumannii: involvement of a novel
chaperone-usher pili assembly system. Microbiology, 149(Pt 12), 3473-3484. doi:

10.1099/mic.0.26541-0

Turner, P. J. (2008). Meropenem activity against European isolates: report on the MYSTIC (Meropenem Yearly Susceptibility Test Information Collection) 2006 results. Diagn Microbiol In!ect Dis, 60(2), 185-192. doi: 10.1016/j.diagmicrobio.2007.09.006
Turner, P. J., Greenhalgh, J. M., & Group, M. S. (2003). The activity of meropenem and comparators against Acinetobacter strains isolated from European hospitals, 1997-2000. Clin Microbiol In!ect, 9(6), 563-567.
Vakulenko, S. B., & Mobashery, S. (2003). Versatility of aminoglycosides and prospects for their future. Clin Microbiol Rev, 16(3), 430-450.
Viehman, J. A., Nguyen, M. R., & Doi, Y. (2014). Treatment options for carbapenem-resistant and extensively drug-resistant Acinetobacter baumannii infections. Drugs, 74(12), 1315-
1333. doi: 10.1007/s40265-014-0267-8

Vila, J., & Pachon, J. (2008). Therapeutic options for Acinetobacter baumannii infections. Expert

Opin Pharmacother, 9(4), 587-599. doi: 10.1517/14656566.9.4.587

Visca, P., Seifert, R., & Towner, K. J. (2011). Acinetobacter infection–an emerging threat to human health. IUBMB Li!e, 63(12), 1048-1054. doi: 10.1002/iub.534
Wachino, J., & Arakawa, Y. (2012). Exogenously acquired 16S rRNA methyltransferases found in aminoglycoside-resistant pathogenic Gram-negative bacteria: an update. Drug Resist Updat, 15(3), 133-148. doi: 10.1016/j.drup.2012.05.001
Wang, Y., Shen, M., Yang, J., Dai, M., Chang, Y., Zhang, C., . . . Jia, X. (2016). Prevalence of carbapenemases among high-level aminoglycoside-resistant Acinetobacter baumannii isolates in a university hospital in China. Exp Ther Med, 12(6), 3642-3652. doi:
10.3892/etm.2016.3828

Wisplinghoff, R., Bischoff, T., Tallent, S. M., Seifert, R., Wenzel, R. P., & Edmond, M. B. (2004).

Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clin In!ect Dis, 39(3), 309-317. doi:
10.1086/421946

Yamane, K., Wachino, J., Doi, Y., Kurokawa, R., & Arakawa, Y. (2005). Global spread of multiple aminoglycoside resistance genes. Emerg In!ect Dis, 11(6), 951-953. doi:
10.3201/eid1106.040924
Yamane, K., Wachino, J., Suzuki, S., Shibata, N., Kato, R., Shibayama, K., . . . Arakawa, Y. (2007). 16S rRNA methylase-producing, gram-negative pathogens, Japan. Emerg In!ect Dis, 13(4), 642-646. doi: 10.3201/eid1304.060501
Zhang, R. Z., Zhang, J. S., & Qiao, L. (2013). The Acinetobacter baumannii group: a systemic review. World J Emerg Med, 4(3), 169-174. doi: 10.5847/wjem.j.1920-8642.2013.03.002
Zhou, Y., Yu, R., Guo, Q., Xu, X., Ye, X., Wu, S., . . . Wang, M. (2010a). Distribution of 16S rRNA methylases among different species of Gram-negative bacilli with high-level resistance to aminoglycosides. Eur J Clin Microbiol In!ect Dis, 29(11), 1349-1353. doi:
10.1007/s10096-010-1004-1

Zhou, Y., Yu, R., Guo, Q., Xu, X., Ye, X., Wu, S., . . . Wang, M. (2010b). Distribution of 16S rRNA methylases among different species of Gram-negative bacilli with high-level resistance to aminoglycosides. European Journal o! Clinical Microbiology &amp; In!ectious Diseases, 29(11), 1349-1353. doi: 10.1007/s10096-010-1004-1